EMAIL THIS PAGE TO A FRIEND

TERF2IP

telomeric repeat binding factor 2, interacting protein

Synonyms: DRIP5 RAP1
UniProtKB ID: Q9NYB0, B4DQN4, Q4W4Y2, Q8WYZ3, Q9NWR2
Gene ID:
Human(54386) Summary: The gene encodes a protein that is part of a complex involved in telomere length regulation. Pseudogenes are present on chromosomes 5 and 22. [provided by RefSeq, Apr 2010]
Mouse(57321) telomeric repeat binding factor 2, interacting protein
Rat(307861) telomeric repeat binding factor 2, interacting protein
cow(509625) telomeric repeat binding factor 2, interacting protein
sheep(101118549) telomeric repeat binding factor 2, interacting protein
domestic guinea pig(100713942) telomeric repeat binding factor 2, interacting protein
naked mole-rat(101705485) telomeric repeat binding factor 2, interacting protein
Zebrafish(407707) telomeric repeat binding factor 2, interacting protein
domestic cat(101097610) telomeric repeat binding factor 2, interacting protein
dog(479643) telomeric repeat binding factor 2, interacting protein
chicken(395122) telomeric repeat binding factor 2, interacting protein
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018975 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041401 MISSION® esiRNA esiRNA human TERF2IP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018975 Rosetta Predictions human pricing
NM_001013143 Rosetta Predictions rat pricing
NM_020584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352466 predicted 569
2 SASI_Hs01_00130741 predicted 1676
3 SASI_Hs01_00130742 predicted 1556
4 SASI_Hs01_00130745 predicted 706
5 SASI_Hs01_00130746 predicted 1589
6 SASI_Hs01_00130747 predicted 1594
7 SASI_Hs01_00130749 predicted 1683
8 SASI_Hs01_00130750 predicted 1784
9 SASI_Hs02_00352467 predicted 1566
10 SASI_Hs02_00352468 predicted 626
11 SASI_Hs01_00130743 predicted 320
12 SASI_Hs01_00130744 predicted 1618
13 SASI_Hs01_00130748 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056318 predicted 994
2 SASI_Rn01_00056319 predicted 846
3 SASI_Rn01_00056320 predicted 275
4 SASI_Rn01_00056321 predicted 1452
5 SASI_Rn01_00056322 predicted 1327
6 SASI_Rn01_00056323 predicted 1256
7 SASI_Rn01_00056324 predicted 1121
8 SASI_Rn01_00056325 predicted 1374
9 SASI_Rn01_00056327 predicted 1320
10 SASI_Rn02_00200868 predicted 1152
11 SASI_Rn01_00056326 predicted 1507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325653 predicted 1420
2 SASI_Mm02_00325654 predicted 1335
3 SASI_Mm02_00325655 predicted 1180
4 SASI_Mm02_00325656 predicted 1068
5 SASI_Mm02_00325657 predicted 1427
6 SASI_Mm02_00325658 predicted 851
7 SASI_Mm02_00325659 predicted 1044
8 SASI_Mm02_00325660 predicted 1261
9 SASI_Mm02_00325661 predicted 1588
10 SASI_Mm02_00325662 predicted 1602
11 SASI_Mm01_00102705 predicted 1221
12 SASI_Mm01_00102706 predicted 688
13 SASI_Mm01_00102707 predicted 605
14 SASI_Mm01_00102708 predicted 546
15 SASI_Mm01_00102709 predicted 1270
16 SASI_Mm01_00102710 predicted 494
17 SASI_Mm01_00102711 predicted 1187
18 SASI_Mm01_00102712 predicted 1152
19 SASI_Mm01_00102713 predicted 1143
20 SASI_Mm01_00102714 predicted 365
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018975
VALIDATED
TERF2IP MISSION shRNA Bacterial Glycerol Stock
telomeric repeat binding factor 2, interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018975.x-567s1c1
Sequence:CCGGCATCCTTACCTACGTGAAGGACTCGAGTCCTTCACGTAGGTAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018975.x-814s1c1
Sequence:CCGGCAGAATAAGAGAACTCCAGATCTCGAGATCTGGAGTTCTCTTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018975.1-1093s1c1
Sequence:CCGGCGGCAGTTAATGGAGAAGTTTCTCGAGAAACTTCTCCATTAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018975.1-554s1c1
Sequence:CCGGCGGACGACGTAGCCATCCTTACTCGAGTAAGGATGGCTACGTCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018975.1-846s1c1
Sequence:CCGGAGAGTATGTGAAGGAAGAAATCTCGAGATTTCTTCCTTCACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018975.2-805s21c1
Sequence:CCGGAGAGTATGTGAAGGAAGAAATCTCGAGATTTCTTCCTTCACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018975.2-1024s21c1
Sequence:CCGGAGAGGTGGGAGCTGCCATTAACTCGAGTTAATGGCAGCTCCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018975.2-1265s21c1
Sequence:CCGGGTAGCTCGGAGGATTGAATTTCTCGAGAAATTCAATCCTCCGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018975.2-1186s21c1
Sequence:CCGGCCGACAAGATGACATAGATTTCTCGAGAAATCTATGTCATCTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018975.2-1373s21c1
Sequence:CCGGGAGAGTTCTTGCATTGGAACTCTCGAGAGTTCCAATGCAAGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018975
VALIDATED
TERF2IP MISSION shRNA shRNA Plasmid DNA
telomeric repeat binding factor 2, interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018975.x-567s1c1
Sequence:CCGGCATCCTTACCTACGTGAAGGACTCGAGTCCTTCACGTAGGTAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018975.x-814s1c1
Sequence:CCGGCAGAATAAGAGAACTCCAGATCTCGAGATCTGGAGTTCTCTTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018975.1-1093s1c1
Sequence:CCGGCGGCAGTTAATGGAGAAGTTTCTCGAGAAACTTCTCCATTAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018975.1-554s1c1
Sequence:CCGGCGGACGACGTAGCCATCCTTACTCGAGTAAGGATGGCTACGTCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018975.1-846s1c1
Sequence:CCGGAGAGTATGTGAAGGAAGAAATCTCGAGATTTCTTCCTTCACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018975.2-805s21c1
Sequence:CCGGAGAGTATGTGAAGGAAGAAATCTCGAGATTTCTTCCTTCACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018975.2-1024s21c1
Sequence:CCGGAGAGGTGGGAGCTGCCATTAACTCGAGTTAATGGCAGCTCCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018975.2-1265s21c1
Sequence:CCGGGTAGCTCGGAGGATTGAATTTCTCGAGAAATTCAATCCTCCGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018975.2-1186s21c1
Sequence:CCGGCCGACAAGATGACATAGATTTCTCGAGAAATCTATGTCATCTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018975.2-1373s21c1
Sequence:CCGGGAGAGTTCTTGCATTGGAACTCTCGAGAGTTCCAATGCAAGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018975
VALIDATED
TERF2IP MISSION shRNA Lentiviral Transduction Particles
telomeric repeat binding factor 2, interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018975.x-567s1c1
Sequence:CCGGCATCCTTACCTACGTGAAGGACTCGAGTCCTTCACGTAGGTAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018975.x-814s1c1
Sequence:CCGGCAGAATAAGAGAACTCCAGATCTCGAGATCTGGAGTTCTCTTATTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018975.1-1093s1c1
Sequence:CCGGCGGCAGTTAATGGAGAAGTTTCTCGAGAAACTTCTCCATTAACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018975.1-554s1c1
Sequence:CCGGCGGACGACGTAGCCATCCTTACTCGAGTAAGGATGGCTACGTCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018975.1-846s1c1
Sequence:CCGGAGAGTATGTGAAGGAAGAAATCTCGAGATTTCTTCCTTCACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018975.2-805s21c1
Sequence:CCGGAGAGTATGTGAAGGAAGAAATCTCGAGATTTCTTCCTTCACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018975.2-1024s21c1
Sequence:CCGGAGAGGTGGGAGCTGCCATTAACTCGAGTTAATGGCAGCTCCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018975.2-1265s21c1
Sequence:CCGGGTAGCTCGGAGGATTGAATTTCTCGAGAAATTCAATCCTCCGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018975.2-1186s21c1
Sequence:CCGGCCGACAAGATGACATAGATTTCTCGAGAAATCTATGTCATCTTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_018975.2-1373s21c1
Sequence:CCGGGAGAGTTCTTGCATTGGAACTCTCGAGAGTTCCAATGCAAGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020584
VALIDATED
TERF2IP MISSION shRNA Bacterial Glycerol Stock
telomeric repeat binding factor 2, interacting protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020584.1-874s1c1
Sequence:CCGGGCCCTGACTTTGAAATACATACTCGAGTATGTATTTCAAAGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020584.1-543s1c1
Sequence:CCGGACAGGCAATGCCTTGTGGAAACTCGAGTTTCCACAAGGCATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020584.1-810s1c1
Sequence:CCGGGAGGCAGACAACAAGCTGTTTCTCGAGAAACAGCTTGTTGTCTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020584.1-308s1c1
Sequence:CCGGCTTCATCTCCACGCAGTACATCTCGAGATGTACTGCGTGGAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020584.1-129s1c1
Sequence:CCGGTCCACTCTGTTCGTGAGAGAACTCGAGTTCTCTCACGAACAGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1032s21c1
Sequence:CCGGAGAAGTGGGAACTGCCATTAACTCGAGTTAATGGCAGTTCCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1140s21c1
Sequence:CCGGCACGTCCTCCTTCTTAGAGTCCTCGAGGACTCTAAGAAGGAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020584.2-1689s21c1
Sequence:CCGGAGAGTCTAGAAGAACGATTTACTCGAGTAAATCGTTCTTCTAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1170s21c1
Sequence:CCGGACCCGACGGTTATCCCATTTGCTCGAGCAAATGGGATAACCGTCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1268s21c1
Sequence:CCGGAGAACGTTGCTCGGAGGATTGCTCGAGCAATCCTCCGAGCAACGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020584
VALIDATED
TERF2IP MISSION shRNA shRNA Plasmid DNA
telomeric repeat binding factor 2, interacting protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020584.1-874s1c1
Sequence:CCGGGCCCTGACTTTGAAATACATACTCGAGTATGTATTTCAAAGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020584.1-543s1c1
Sequence:CCGGACAGGCAATGCCTTGTGGAAACTCGAGTTTCCACAAGGCATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020584.1-810s1c1
Sequence:CCGGGAGGCAGACAACAAGCTGTTTCTCGAGAAACAGCTTGTTGTCTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020584.1-308s1c1
Sequence:CCGGCTTCATCTCCACGCAGTACATCTCGAGATGTACTGCGTGGAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020584.1-129s1c1
Sequence:CCGGTCCACTCTGTTCGTGAGAGAACTCGAGTTCTCTCACGAACAGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1032s21c1
Sequence:CCGGAGAAGTGGGAACTGCCATTAACTCGAGTTAATGGCAGTTCCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1140s21c1
Sequence:CCGGCACGTCCTCCTTCTTAGAGTCCTCGAGGACTCTAAGAAGGAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020584.2-1689s21c1
Sequence:CCGGAGAGTCTAGAAGAACGATTTACTCGAGTAAATCGTTCTTCTAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1170s21c1
Sequence:CCGGACCCGACGGTTATCCCATTTGCTCGAGCAAATGGGATAACCGTCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1268s21c1
Sequence:CCGGAGAACGTTGCTCGGAGGATTGCTCGAGCAATCCTCCGAGCAACGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020584
VALIDATED
TERF2IP MISSION shRNA Lentiviral Transduction Particles
telomeric repeat binding factor 2, interacting protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020584.1-874s1c1
Sequence:CCGGGCCCTGACTTTGAAATACATACTCGAGTATGTATTTCAAAGTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020584.1-543s1c1
Sequence:CCGGACAGGCAATGCCTTGTGGAAACTCGAGTTTCCACAAGGCATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020584.1-810s1c1
Sequence:CCGGGAGGCAGACAACAAGCTGTTTCTCGAGAAACAGCTTGTTGTCTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_020584.1-308s1c1
Sequence:CCGGCTTCATCTCCACGCAGTACATCTCGAGATGTACTGCGTGGAGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020584.1-129s1c1
Sequence:CCGGTCCACTCTGTTCGTGAGAGAACTCGAGTTCTCTCACGAACAGAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1032s21c1
Sequence:CCGGAGAAGTGGGAACTGCCATTAACTCGAGTTAATGGCAGTTCCCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1140s21c1
Sequence:CCGGCACGTCCTCCTTCTTAGAGTCCTCGAGGACTCTAAGAAGGAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425939    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020584.2-1689s21c1
Sequence:CCGGAGAGTCTAGAAGAACGATTTACTCGAGTAAATCGTTCTTCTAGACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1170s21c1
Sequence:CCGGACCCGACGGTTATCCCATTTGCTCGAGCAAATGGGATAACCGTCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020584.2-1268s21c1
Sequence:CCGGAGAACGTTGCTCGGAGGATTGCTCGAGCAATCCTCCGAGCAACGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks