EMAIL THIS PAGE TO A FRIEND

TERT

telomerase reverse transcriptase

Synonyms: CMM9 DKCA2 DKCB4 EST2 PFBMFT1 TCS1 TP2 TRT hEST2 hTRT
UniProtKB ID: O14746, O14783, Q2XS35, Q8N6C3, Q8NG46
Gene ID:
Human(7015) Summary: Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]
Mouse(21752) telomerase reverse transcriptase
Rat(301965) telomerase reverse transcriptase
Thale Cress(831548) telomerase reverse transcriptase
domestic cat(100144612) telomerase reverse transcriptase
dog(403412) telomerase reverse transcriptase
chicken(420972) telomerase reverse transcriptase
Zebrafish(796551) telomerase reverse transcriptase
naked mole-rat(101706965) telomerase reverse transcriptase
domestic guinea pig(100732437) telomerase reverse transcriptase
cow(518884) telomerase reverse transcriptase
sheep(100126866) telomerase reverse transcriptase
sheep(101112422) telomerase reverse transcriptase
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009354 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009354 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009354 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198253 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_003219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003219 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU001801 MISSION® esiRNA esiRNA targeting mouse Tert (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003219 Rosetta Predictions human pricing
NM_198253 Rosetta Predictions human pricing
NM_198254 Rosetta Predictions human pricing
NM_198255 Rosetta Predictions human pricing
NM_053423 Rosetta Predictions rat pricing
XM_001052969 Rosetta Predictions rat pricing
XM_001052970 Rosetta Predictions rat pricing
NM_009354 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151045 predicted 1329
2 SASI_Hs01_00151046 predicted 1799
3 SASI_Hs01_00151047 predicted 1815
4 SASI_Hs01_00151048 predicted 748
5 SASI_Hs01_00151049 predicted 1024
6 SASI_Hs01_00151050 predicted 3493
7 SASI_Hs01_00151051 predicted 1052
8 SASI_Hs01_00151052 predicted 860
9 SASI_Hs01_00151053 predicted 886
10 SASI_Hs01_00151054 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371784 predicted 2765
2 SASI_Hs02_00371785 predicted 2956
3 SASI_Hs02_00371786 predicted 740
4 SASI_Hs02_00371787 predicted 2639
5 SASI_Hs02_00371788 predicted 2597
6 SASI_Hs02_00371789 predicted 3493
7 SASI_Hs01_00070975 predicted 1047
8 SASI_Hs02_00371790 predicted 2650
9 SASI_Hs01_00070976 predicted 889
10 SASI_Hs02_00371791 predicted 2895
11 SASI_Hs01_00070973 predicted 849
12 SASI_Hs01_00070974 predicted 1810
13 SASI_Hs01_00070977 predicted 1790
14 SASI_Hs01_00070978 predicted 1709
15 SASI_Hs01_00070979 predicted 1950
16 SASI_Hs01_00070980 predicted 902
17 SASI_Hs01_00070981 predicted 1679
18 SASI_Hs01_00070982 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223075 predicted 852
2 SASI_Hs01_00223076 predicted 1808
3 SASI_Hs01_00223077 predicted 1047
4 SASI_Hs01_00223078 predicted 886
5 SASI_Hs01_00223079 predicted 1795
6 SASI_Hs01_00223080 predicted 1706
7 SASI_Hs01_00223081 predicted 1951
8 SASI_Hs01_00223082 predicted 902
9 SASI_Hs01_00223083 predicted 1684
10 SASI_Hs01_00223084 predicted 1135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371792 predicted 2724
2 SASI_Hs02_00371793 predicted 2912
3 SASI_Hs01_00197553 predicted 744
4 SASI_Hs02_00371794 predicted 2610
5 SASI_Hs02_00371795 predicted 2561
6 SASI_Hs01_00197555 predicted 3463
7 SASI_Hs01_00197556 predicted 1048
8 SASI_Hs02_00371796 predicted 2621
9 SASI_Hs01_00197558 predicted 890
10 SASI_Hs02_00371797 predicted 2861
11 SASI_Hs01_00197550 predicted 1321
12 SASI_Hs01_00197551 predicted 1803
13 SASI_Hs01_00197552 predicted 1816
14 SASI_Hs01_00197554 predicted 1025
15 SASI_Hs01_00197557 predicted 854
16 SASI_Hs01_00197559 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103721 predicted 2908
2 SASI_Rn01_00103722 predicted 3123
3 SASI_Rn01_00103723 predicted 2966
4 SASI_Rn01_00103724 predicted 1312
5 SASI_Rn01_00103725 predicted 2278
6 SASI_Rn01_00103726 predicted 2173
7 SASI_Rn01_00103727 predicted 1409
8 SASI_Rn02_00265966 predicted 3059
9 SASI_Rn01_00103728 predicted 1034
10 SASI_Rn01_00103729 predicted 1750
11 SASI_Rn01_00103720 predicted 2798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270834 predicted 2316
2 SASI_Rn02_00270835 predicted 878
3 SASI_Rn02_00270836 predicted 1307
4 SASI_Rn02_00270837 predicted 2327
5 SASI_Rn02_00270838 predicted 553
6 SASI_Rn02_00270839 predicted 1106
7 SASI_Rn02_00270840 predicted 1029
8 SASI_Rn02_00270841 predicted 2330
9 SASI_Rn02_00270842 predicted 396
10 SASI_Rn02_00270843 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270844 predicted 1470
2 SASI_Rn02_00270845 predicted 1311
3 SASI_Rn02_00270846 predicted 1411
4 SASI_Rn02_00270847 predicted 1418
5 SASI_Rn02_00270848 predicted 1663
6 SASI_Rn02_00270849 predicted 1033
7 SASI_Rn02_00270850 predicted 1565
8 SASI_Rn02_00270851 predicted 1889
9 SASI_Rn02_00270852 predicted 1536
10 SASI_Rn02_00270853 predicted 1735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009354 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047266 predicted 756
2 SASI_Mm01_00047267 predicted 2675
3 SASI_Mm02_00315945 predicted 2997
4 SASI_Mm01_00047268 predicted 2939
5 SASI_Mm01_00047269 predicted 3157
6 SASI_Mm01_00047270 predicted 1438
7 SASI_Mm01_00047271 predicted 385
8 SASI_Mm01_00047272 predicted 1282
9 SASI_Mm01_00047273 predicted 3084
10 SASI_Mm01_00047274 predicted 830
11 SASI_Mm01_00047265 predicted 323
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009354
VALIDATED
TERT MISSION shRNA Bacterial Glycerol Stock
telomerase reverse transcriptase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-1365s21c1
Sequence:CCGGAGCAGTCCCTGGCAGGTATATCTCGAGATATACCTGCCAGGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-2990s21c1
Sequence:CCGGCCAGACAGTCTGCATCAATATCTCGAGATATTGATGCAGACTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-2946s21c1
Sequence:CCGGTTGAAGTGTCACGGTCTATTTCTCGAGAAATAGACCGTGACACTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-2853s21c1
Sequence:CCGGTATGCCCAGACCTCAATTAAGCTCGAGCTTAATTGAGGTCTGGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-1452s1c1
Sequence:CCGGCGCCGCTTCTTTAAGAACTTACTCGAGTAAGTTCTTAAAGAAGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-1991s1c1
Sequence:CCGGGCTCAACTATGAGCGGACAAACTCGAGTTTGTCCGCTCATAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009354.1-1011s1c1
Sequence:CCGGCCATTTATTGAGACCAGACATCTCGAGATGTCTGGTCTCAATAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-2448s1c1
Sequence:CCGGCGTCACAGTGTCGTAAAGATTCTCGAGAATCTTTACGACACTGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-3249s1c1
Sequence:CCGGGCTCATTCTGTCATCTACAAACTCGAGTTTGTAGATGACAGAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009354
VALIDATED
TERT MISSION shRNA shRNA Plasmid DNA
telomerase reverse transcriptase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-1365s21c1
Sequence:CCGGAGCAGTCCCTGGCAGGTATATCTCGAGATATACCTGCCAGGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-2990s21c1
Sequence:CCGGCCAGACAGTCTGCATCAATATCTCGAGATATTGATGCAGACTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-2946s21c1
Sequence:CCGGTTGAAGTGTCACGGTCTATTTCTCGAGAAATAGACCGTGACACTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-2853s21c1
Sequence:CCGGTATGCCCAGACCTCAATTAAGCTCGAGCTTAATTGAGGTCTGGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-1452s1c1
Sequence:CCGGCGCCGCTTCTTTAAGAACTTACTCGAGTAAGTTCTTAAAGAAGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-1991s1c1
Sequence:CCGGGCTCAACTATGAGCGGACAAACTCGAGTTTGTCCGCTCATAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009354.1-1011s1c1
Sequence:CCGGCCATTTATTGAGACCAGACATCTCGAGATGTCTGGTCTCAATAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-2448s1c1
Sequence:CCGGCGTCACAGTGTCGTAAAGATTCTCGAGAATCTTTACGACACTGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-3249s1c1
Sequence:CCGGGCTCATTCTGTCATCTACAAACTCGAGTTTGTAGATGACAGAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009354
VALIDATED
TERT MISSION shRNA Lentiviral Transduction Particles
telomerase reverse transcriptase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-1365s21c1
Sequence:CCGGAGCAGTCCCTGGCAGGTATATCTCGAGATATACCTGCCAGGGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-2990s21c1
Sequence:CCGGCCAGACAGTCTGCATCAATATCTCGAGATATTGATGCAGACTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-2946s21c1
Sequence:CCGGTTGAAGTGTCACGGTCTATTTCTCGAGAAATAGACCGTGACACTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009354.1-2853s21c1
Sequence:CCGGTATGCCCAGACCTCAATTAAGCTCGAGCTTAATTGAGGTCTGGGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-1452s1c1
Sequence:CCGGCGCCGCTTCTTTAAGAACTTACTCGAGTAAGTTCTTAAAGAAGCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-1991s1c1
Sequence:CCGGGCTCAACTATGAGCGGACAAACTCGAGTTTGTCCGCTCATAGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009354.1-1011s1c1
Sequence:CCGGCCATTTATTGAGACCAGACATCTCGAGATGTCTGGTCTCAATAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-2448s1c1
Sequence:CCGGCGTCACAGTGTCGTAAAGATTCTCGAGAATCTTTACGACACTGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009354.1-3249s1c1
Sequence:CCGGGCTCATTCTGTCATCTACAAACTCGAGTTTGTAGATGACAGAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198253
VALIDATED
TERT MISSION shRNA Bacterial Glycerol Stock
telomerase reverse transcriptase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-3183s21c1
Sequence:CCGGTCTGCTACTCCATCCTGAAAGCTCGAGCTTTCAGGATGGAGTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-1743s21c1
Sequence:CCGGATGTCACGGAGACCACGTTTCCTCGAGGAAACGTGGTCTCCGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198253.2-3762s21c1
Sequence:CCGGCCCACATAGGAATAGTCCATCCTCGAGGATGGACTATTCCTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198253.2-3572s1c1
Sequence:CCGGTGAGGCCTGAGTGAGTGTTTGCTCGAGCAAACACTCACTCAGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198253.2-2647s1c1
Sequence:CCGGCCTGCGTTTGGTGGATGATTTCTCGAGAAATCATCCACCAAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-3043s21c1
Sequence:CCGGGACGGTGTGCACCAACATCTACTCGAGTAGATGTTGGTGCACACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-2964s21c1
Sequence:CCGGACATGCGTCGCAAACTCTTTGCTCGAGCAAAGAGTTTGCGACGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198253
VALIDATED
TERT MISSION shRNA shRNA Plasmid DNA
telomerase reverse transcriptase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-3183s21c1
Sequence:CCGGTCTGCTACTCCATCCTGAAAGCTCGAGCTTTCAGGATGGAGTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-1743s21c1
Sequence:CCGGATGTCACGGAGACCACGTTTCCTCGAGGAAACGTGGTCTCCGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198253.2-3762s21c1
Sequence:CCGGCCCACATAGGAATAGTCCATCCTCGAGGATGGACTATTCCTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198253.2-3572s1c1
Sequence:CCGGTGAGGCCTGAGTGAGTGTTTGCTCGAGCAAACACTCACTCAGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198253.2-2647s1c1
Sequence:CCGGCCTGCGTTTGGTGGATGATTTCTCGAGAAATCATCCACCAAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-3043s21c1
Sequence:CCGGGACGGTGTGCACCAACATCTACTCGAGTAGATGTTGGTGCACACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-2964s21c1
Sequence:CCGGACATGCGTCGCAAACTCTTTGCTCGAGCAAAGAGTTTGCGACGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198253
VALIDATED
TERT MISSION shRNA Lentiviral Transduction Particles
telomerase reverse transcriptase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-3183s21c1
Sequence:CCGGTCTGCTACTCCATCCTGAAAGCTCGAGCTTTCAGGATGGAGTAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-1743s21c1
Sequence:CCGGATGTCACGGAGACCACGTTTCCTCGAGGAAACGTGGTCTCCGTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198253.2-3762s21c1
Sequence:CCGGCCCACATAGGAATAGTCCATCCTCGAGGATGGACTATTCCTATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198253.2-3572s1c1
Sequence:CCGGTGAGGCCTGAGTGAGTGTTTGCTCGAGCAAACACTCACTCAGGCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_198253.2-2647s1c1
Sequence:CCGGCCTGCGTTTGGTGGATGATTTCTCGAGAAATCATCCACCAAACGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-3043s21c1
Sequence:CCGGGACGGTGTGCACCAACATCTACTCGAGTAGATGTTGGTGCACACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_198253.2-2964s21c1
Sequence:CCGGACATGCGTCGCAAACTCTTTGCTCGAGCAAAGAGTTTGCGACGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003219
VALIDATED
TERT MISSION shRNA Bacterial Glycerol Stock
telomerase reverse transcriptase
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000180780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003219.1-1786s1c1
Sequence:CCGGGAAGAGTGTCTGGAGCAAGTTCTCGAGAACTTGCTCCAGACACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003219.1-1812s1c1
Sequence:CCGGGCATTGGAATCAGACAGCACTCTCGAGAGTGCTGTCTGATTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003219.1-2597s1c1
Sequence:CCGGGACATGGAGAACAAGCTGTTTCTCGAGAAACAGCTTGTTCTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003219
VALIDATED
TERT MISSION shRNA shRNA Plasmid DNA
telomerase reverse transcriptase
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000180780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003219.1-1786s1c1
Sequence:CCGGGAAGAGTGTCTGGAGCAAGTTCTCGAGAACTTGCTCCAGACACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003219.1-1812s1c1
Sequence:CCGGGCATTGGAATCAGACAGCACTCTCGAGAGTGCTGTCTGATTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003219.1-2597s1c1
Sequence:CCGGGACATGGAGAACAAGCTGTTTCTCGAGAAACAGCTTGTTCTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003219
VALIDATED
TERT MISSION shRNA Lentiviral Transduction Particles
telomerase reverse transcriptase
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000180780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003219.1-1786s1c1
Sequence:CCGGGAAGAGTGTCTGGAGCAAGTTCTCGAGAACTTGCTCCAGACACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003219.1-1812s1c1
Sequence:CCGGGCATTGGAATCAGACAGCACTCTCGAGAGTGCTGTCTGATTCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003219.1-2597s1c1
Sequence:CCGGGACATGGAGAACAAGCTGTTTCTCGAGAAACAGCTTGTTCTCCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks