EMAIL THIS PAGE TO A FRIEND

TES

testis derived transcript (3 LIM domains)

Synonyms: TESS TESS-2
UniProtKB ID: Q9UGI8, A4D0U6, Q9GZQ1, Q9HAJ9
Gene ID:
Human(26136) Summary: Cancer-associated chromosomal changes often involve regions containing fragile sites. This gene maps to a commom fragile site on chromosome 7q31.2 designated FRA7G. This gene is similar to mouse Testin, a testosterone-responsive gene encoding a Sertoli cell secretory protein containing three LIM domains. LIM domains are double zinc-finger motifs that mediate protein-protein interactions between transcription factors, cytoskeletal proteins and signaling proteins. This protein is a negative regulator of cell growth and may act as a tumor suppressor. This scaffold protein may also play a role in cell adhesion, cell spreading and in the reorganization of the actin cytoskeleton. Multiple protein isoforms are encoded by transcript variants of this gene.[provided by RefSeq, Mar 2011]
Mouse(21753) testis derived transcript
Rat(500040) testis derived transcript
cow(534965) testis derived transcript (3 LIM domains)
sheep(100126573) testis derived transcript (3 LIM domains)
domestic guinea pig(100135641) testis derived transcript
domestic guinea pig(100718235) testis derived transcript (3 LIM domains)
naked mole-rat(101697592) testis derived transcript (3 LIM domains)
Domestic Rabbit(100126564) testis derived transcript (3 LIM domains)
fruit fly(36965) Testin ortholog
Horse(100071093) testis derived transcript (3 LIM domains)
domestic cat(100137197) testis derived transcript (3 LIM domains)
dog(475293) testis derived transcript (3 LIM domains)
chicken(395332) testis derived transcript (3 LIM domains)
Zebrafish(403032) testis derived transcript (3 LIM domains)
Thale Cress(823396) kinesin TETRASPORE
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015641 Rosetta Predictions human pricing
NM_152829 Rosetta Predictions human pricing
NM_001039344 Rosetta Predictions rat pricing
NM_011570 Rosetta Predictions mouse pricing
NM_207176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109622 predicted 494
2 SASI_Hs01_00109623 predicted 1134
3 SASI_Hs01_00109624 predicted 1186
4 SASI_Hs01_00109625 predicted 1037
5 SASI_Hs01_00109626 predicted 1241
6 SASI_Hs01_00109627 predicted 887
7 SASI_Hs01_00109628 predicted 429
8 SASI_Hs01_00109630 predicted 417
9 SASI_Hs02_00348247 predicted 624
10 SASI_Hs02_00348248 predicted 850
11 SASI_Hs01_00109629 predicted 1105
12 SASI_Hs01_00109631 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130561 predicted 332
2 SASI_Hs01_00130562 predicted 972
3 SASI_Hs01_00130563 predicted 1028
4 SASI_Hs01_00130564 predicted 867
5 SASI_Hs01_00130565 predicted 1078
6 SASI_Hs01_00130566 predicted 730
7 SASI_Hs01_00130567 predicted 272
8 SASI_Hs01_00130569 predicted 262
9 SASI_Hs02_00366745 predicted 464
10 SASI_Hs02_00366746 predicted 688
11 SASI_Hs01_00130568 predicted 936
12 SASI_Hs01_00130570 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056855 predicted 375
2 SASI_Rn01_00056858 predicted 364
3 SASI_Rn01_00056859 predicted 254
4 SASI_Rn01_00056860 predicted 380
5 SASI_Rn02_00204829 predicted 586
6 SASI_Rn01_00056862 predicted 814
7 SASI_Rn02_00204830 predicted 567
8 SASI_Rn02_00204831 predicted 642
9 SASI_Rn01_00056863 predicted 677
10 SASI_Rn02_00204832 predicted 316
11 SASI_Rn01_00056854 predicted 350
12 SASI_Rn01_00056856 predicted 1119
13 SASI_Rn01_00056857 predicted 756
14 SASI_Rn01_00056861 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127057 predicted 1624
2 SASI_Mm01_00127058 predicted 674
3 SASI_Mm01_00127059 predicted 471
4 SASI_Mm01_00127060 predicted 695
5 SASI_Mm01_00127061 predicted 550
6 SASI_Mm01_00127062 predicted 1491
7 SASI_Mm01_00127063 predicted 638
8 SASI_Mm01_00127064 predicted 690
9 SASI_Mm01_00127065 predicted 1185
10 SASI_Mm01_00127066 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038623 predicted 430
2 SASI_Mm02_00351919 predicted 1251
3 SASI_Mm01_00038625 predicted 451
4 SASI_Mm01_00038628 predicted 451
5 SASI_Mm01_00038629 predicted 392
6 SASI_Mm01_00038630 predicted 942
7 SASI_Mm01_00038631 predicted 325
8 SASI_Mm02_00351920 predicted 304
9 SASI_Mm02_00351921 predicted 1111
10 SASI_Mm02_00351922 predicted 232
11 SASI_Mm01_00038622 predicted 1338
12 SASI_Mm01_00038624 predicted 188
13 SASI_Mm01_00038626 predicted 261
14 SASI_Mm01_00038627 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011570
VALIDATED
TES MISSION shRNA Bacterial Glycerol Stock
testis derived transcript (3 LIM domains)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-1893s1c1
Sequence:CCGGGCTTGAATTTAATCAGTCCTTCTCGAGAAGGACTGATTAAATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-1488s1c1
Sequence:CCGGGCAGCGAGTAACGTACAACAACTCGAGTTGTTGTACGTTACTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-1611s1c1
Sequence:CCGGCGTGGAGTGTAAGAGGATGATCTCGAGATCATCCTCTTACACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-570s1c1
Sequence:CCGGGAGACTCTTTGAGGACACTAACTCGAGTTAGTGTCCTCAAAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-631s1c1
Sequence:CCGGCCCATGTACAAACGCAATGTTCTCGAGAACATTGCGTTTGTACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011570
VALIDATED
TES MISSION shRNA shRNA Plasmid DNA
testis derived transcript (3 LIM domains)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-1893s1c1
Sequence:CCGGGCTTGAATTTAATCAGTCCTTCTCGAGAAGGACTGATTAAATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-1488s1c1
Sequence:CCGGGCAGCGAGTAACGTACAACAACTCGAGTTGTTGTACGTTACTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-1611s1c1
Sequence:CCGGCGTGGAGTGTAAGAGGATGATCTCGAGATCATCCTCTTACACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-570s1c1
Sequence:CCGGGAGACTCTTTGAGGACACTAACTCGAGTTAGTGTCCTCAAAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-631s1c1
Sequence:CCGGCCCATGTACAAACGCAATGTTCTCGAGAACATTGCGTTTGTACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011570
VALIDATED
TES MISSION shRNA Lentiviral Transduction Particles
testis derived transcript (3 LIM domains)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-1893s1c1
Sequence:CCGGGCTTGAATTTAATCAGTCCTTCTCGAGAAGGACTGATTAAATTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-1488s1c1
Sequence:CCGGGCAGCGAGTAACGTACAACAACTCGAGTTGTTGTACGTTACTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-1611s1c1
Sequence:CCGGCGTGGAGTGTAAGAGGATGATCTCGAGATCATCCTCTTACACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-570s1c1
Sequence:CCGGGAGACTCTTTGAGGACACTAACTCGAGTTAGTGTCCTCAAAGAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011570.2-631s1c1
Sequence:CCGGCCCATGTACAAACGCAATGTTCTCGAGAACATTGCGTTTGTACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015641
VALIDATED
TES MISSION shRNA Bacterial Glycerol Stock
testis derived transcript (3 LIM domains)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015641.2-277s1c1
Sequence:CCGGCGAACTGCACTTCTGGAGAAACTCGAGTTTCTCCAGAAGTGCAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015641.2-1381s1c1
Sequence:CCGGGCAGAAGTTCATGCCAGTAGACTCGAGTCTACTGGCATGAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015641.2-2124s1c1
Sequence:CCGGGCATAACAGTATCCACACTTTCTCGAGAAAGTGTGGATACTGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015641.2-1193s1c1
Sequence:CCGGGAGATATACGTGATGGTCAATCTCGAGATTGACCATCACGTATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015641.2-346s1c1
Sequence:CCGGGAGCAATGAAGAGGATCGAAACTCGAGTTTCGATCCTCTTCATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015641.2-1099s1c1
Sequence:CCGGGCTGATATTCAGCAATGAGTACTCGAGTACTCATTGCTGAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-1193s21c1
Sequence:CCGGGAGATATACGTGATGGTCAATCTCGAGATTGACCATCACGTATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-937s21c1
Sequence:CCGGCGAAAGGGCTGGCTATGATAACTCGAGTTATCATAGCCAGCCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-1099s21c1
Sequence:CCGGGCTGATATTCAGCAATGAGTACTCGAGTACTCATTGCTGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-2124s21c1
Sequence:CCGGGCATAACAGTATCCACACTTTCTCGAGAAAGTGTGGATACTGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015641
VALIDATED
TES MISSION shRNA shRNA Plasmid DNA
testis derived transcript (3 LIM domains)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015641.2-277s1c1
Sequence:CCGGCGAACTGCACTTCTGGAGAAACTCGAGTTTCTCCAGAAGTGCAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015641.2-1381s1c1
Sequence:CCGGGCAGAAGTTCATGCCAGTAGACTCGAGTCTACTGGCATGAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015641.2-2124s1c1
Sequence:CCGGGCATAACAGTATCCACACTTTCTCGAGAAAGTGTGGATACTGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015641.2-1193s1c1
Sequence:CCGGGAGATATACGTGATGGTCAATCTCGAGATTGACCATCACGTATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015641.2-346s1c1
Sequence:CCGGGAGCAATGAAGAGGATCGAAACTCGAGTTTCGATCCTCTTCATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015641.2-1099s1c1
Sequence:CCGGGCTGATATTCAGCAATGAGTACTCGAGTACTCATTGCTGAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-1193s21c1
Sequence:CCGGGAGATATACGTGATGGTCAATCTCGAGATTGACCATCACGTATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-937s21c1
Sequence:CCGGCGAAAGGGCTGGCTATGATAACTCGAGTTATCATAGCCAGCCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-1099s21c1
Sequence:CCGGGCTGATATTCAGCAATGAGTACTCGAGTACTCATTGCTGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-2124s21c1
Sequence:CCGGGCATAACAGTATCCACACTTTCTCGAGAAAGTGTGGATACTGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015641
VALIDATED
TES MISSION shRNA Lentiviral Transduction Particles
testis derived transcript (3 LIM domains)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015641.2-277s1c1
Sequence:CCGGCGAACTGCACTTCTGGAGAAACTCGAGTTTCTCCAGAAGTGCAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015641.2-1381s1c1
Sequence:CCGGGCAGAAGTTCATGCCAGTAGACTCGAGTCTACTGGCATGAACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151065    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015641.2-2124s1c1
Sequence:CCGGGCATAACAGTATCCACACTTTCTCGAGAAAGTGTGGATACTGTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015641.2-1193s1c1
Sequence:CCGGGAGATATACGTGATGGTCAATCTCGAGATTGACCATCACGTATATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015641.2-346s1c1
Sequence:CCGGGAGCAATGAAGAGGATCGAAACTCGAGTTTCGATCCTCTTCATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015641.2-1099s1c1
Sequence:CCGGGCTGATATTCAGCAATGAGTACTCGAGTACTCATTGCTGAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-1193s21c1
Sequence:CCGGGAGATATACGTGATGGTCAATCTCGAGATTGACCATCACGTATATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-937s21c1
Sequence:CCGGCGAAAGGGCTGGCTATGATAACTCGAGTTATCATAGCCAGCCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-1099s21c1
Sequence:CCGGGCTGATATTCAGCAATGAGTACTCGAGTACTCATTGCTGAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015641.2-2124s21c1
Sequence:CCGGGCATAACAGTATCCACACTTTCTCGAGAAAGTGTGGATACTGTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207176
TES MISSION shRNA Bacterial Glycerol Stock
testis derived transcript (3 LIM domains)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-306s21c1
Sequence:CCGGCAATGAGGAGGACCGGAAAGTCTCGAGACTTTCCGGTCCTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-716s21c1
Sequence:CCGGAGTTTCCCTCTGAGATGAATGCTCGAGCATTCATCTCAGAGGGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-393s21c1
Sequence:CCGGCATGTACAAACGCAACGTTATCTCGAGATAACGTTGCGTTTGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-1279s21c1
Sequence:CCGGCACGCATCCACAGAGTGTTTCCTCGAGGAAACACTCTGTGGATGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-452s21c1
Sequence:CCGGCCATCAACACAGTTACCTATGCTCGAGCATAGGTAACTGTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207176
TES MISSION shRNA shRNA Plasmid DNA
testis derived transcript (3 LIM domains)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-306s21c1
Sequence:CCGGCAATGAGGAGGACCGGAAAGTCTCGAGACTTTCCGGTCCTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-716s21c1
Sequence:CCGGAGTTTCCCTCTGAGATGAATGCTCGAGCATTCATCTCAGAGGGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-393s21c1
Sequence:CCGGCATGTACAAACGCAACGTTATCTCGAGATAACGTTGCGTTTGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-1279s21c1
Sequence:CCGGCACGCATCCACAGAGTGTTTCCTCGAGGAAACACTCTGTGGATGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-452s21c1
Sequence:CCGGCCATCAACACAGTTACCTATGCTCGAGCATAGGTAACTGTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207176
TES MISSION shRNA Lentiviral Transduction Particles
testis derived transcript (3 LIM domains)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-306s21c1
Sequence:CCGGCAATGAGGAGGACCGGAAAGTCTCGAGACTTTCCGGTCCTCCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-716s21c1
Sequence:CCGGAGTTTCCCTCTGAGATGAATGCTCGAGCATTCATCTCAGAGGGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-393s21c1
Sequence:CCGGCATGTACAAACGCAACGTTATCTCGAGATAACGTTGCGTTTGTACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-1279s21c1
Sequence:CCGGCACGCATCCACAGAGTGTTTCCTCGAGGAAACACTCTGTGGATGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207176.3-452s21c1
Sequence:CCGGCCATCAACACAGTTACCTATGCTCGAGCATAGGTAACTGTGTTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks