EMAIL THIS PAGE TO A FRIEND

TESC

tescalcin

Synonyms: CHP3 TSC
UniProtKB ID: Q96BS2, F5H1Y5, Q9NWT9
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017899 Rosetta Predictions human pricing
XM_001076953 Rosetta Predictions rat pricing
XM_213790 Rosetta Predictions rat pricing
NM_021344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350875 predicted 555
2 SASI_Hs01_00189398 predicted 597
3 SASI_Hs01_00189399 predicted 394
4 SASI_Hs01_00189400 predicted 591
5 SASI_Hs01_00189401 predicted 420
6 SASI_Hs01_00189402 predicted 739
7 SASI_Hs01_00189404 predicted 681
8 SASI_Hs01_00189405 predicted 751
9 SASI_Hs01_00189406 predicted 395
10 SASI_Hs01_00189407 predicted 759
11 SASI_Hs01_00189403 predicted 498
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00355162 predicted 583
2 SASI_Rn02_00355163 predicted 389
3 SASI_Rn02_00355164 predicted 436
4 SASI_Rn02_00355165 predicted 297
5 SASI_Rn02_00355166 predicted 396
6 SASI_Rn02_00355167 predicted 239
7 SASI_Rn02_00355168 predicted 342
8 SASI_Rn02_00355169 predicted 261
9 SASI_Rn02_00355170 predicted 564
10 SASI_Rn02_00355171 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374916 predicted 679
2 SASI_Rn02_00374917 predicted 494
3 SASI_Rn02_00374918 predicted 485
4 SASI_Rn02_00374919 predicted 537
5 SASI_Rn02_00374920 predicted 522
6 SASI_Rn02_00374921 predicted 497
7 SASI_Rn02_00374922 predicted 482
8 SASI_Rn02_00374923 predicted 514
9 SASI_Rn02_00374924 predicted 660
10 SASI_Rn02_00374925 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151811 predicted 679
2 SASI_Mm01_00151813 predicted 490
3 SASI_Mm01_00151814 predicted 362
4 SASI_Mm01_00151815 predicted 529
5 SASI_Mm01_00151816 predicted 692
6 SASI_Mm01_00151817 predicted 364
7 SASI_Mm01_00151818 predicted 536
8 SASI_Mm01_00151819 predicted 495
9 SASI_Mm01_00151820 predicted 701
10 SASI_Mm02_00325925 predicted 348
11 SASI_Mm01_00151812 predicted 453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017899
VALIDATED
TESC MISSION shRNA Bacterial Glycerol Stock
tescalcin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-398s21c1
Sequence:CCGGCCTGGCTGATGAGATCAATTTCTCGAGAAATTGATCTCATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-242s21c1
Sequence:CCGGGCAGCTCCATCGGAGATTTAACTCGAGTTAAATCTCCGATGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-270s21c1
Sequence:CCGGAGTGGAGATCAGCCTACCATTCTCGAGAATGGTAGGCTGATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-428s21c1
Sequence:CCGGCCTGACCATCATGTCCTACTTCTCGAGAAGTAGGACATGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-549s21c1
Sequence:CCGGCGCATCACTCTGGAAGAATATCTCGAGATATTCTTCCAGAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-441s1c1
Sequence:CCGGCCTGGCTGATGAGATCAATTTCTCGAGAAATTGATCTCATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-471s1c1
Sequence:CCGGCCTGACCATCATGTCCTACTTCTCGAGAAGTAGGACATGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017899.1-313s1c1
Sequence:CCGGAGTGGAGATCAGCCTACCATTCTCGAGAATGGTAGGCTGATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-285s1c1
Sequence:CCGGGCAGCTCCATCGGAGATTTAACTCGAGTTAAATCTCCGATGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-592s1c1
Sequence:CCGGCGCATCACTCTGGAAGAATATCTCGAGATATTCTTCCAGAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017899
VALIDATED
TESC MISSION shRNA shRNA Plasmid DNA
tescalcin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-398s21c1
Sequence:CCGGCCTGGCTGATGAGATCAATTTCTCGAGAAATTGATCTCATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-242s21c1
Sequence:CCGGGCAGCTCCATCGGAGATTTAACTCGAGTTAAATCTCCGATGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-270s21c1
Sequence:CCGGAGTGGAGATCAGCCTACCATTCTCGAGAATGGTAGGCTGATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-428s21c1
Sequence:CCGGCCTGACCATCATGTCCTACTTCTCGAGAAGTAGGACATGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-549s21c1
Sequence:CCGGCGCATCACTCTGGAAGAATATCTCGAGATATTCTTCCAGAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-441s1c1
Sequence:CCGGCCTGGCTGATGAGATCAATTTCTCGAGAAATTGATCTCATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-471s1c1
Sequence:CCGGCCTGACCATCATGTCCTACTTCTCGAGAAGTAGGACATGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017899.1-313s1c1
Sequence:CCGGAGTGGAGATCAGCCTACCATTCTCGAGAATGGTAGGCTGATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-285s1c1
Sequence:CCGGGCAGCTCCATCGGAGATTTAACTCGAGTTAAATCTCCGATGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-592s1c1
Sequence:CCGGCGCATCACTCTGGAAGAATATCTCGAGATATTCTTCCAGAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017899
VALIDATED
TESC MISSION shRNA Lentiviral Transduction Particles
tescalcin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-398s21c1
Sequence:CCGGCCTGGCTGATGAGATCAATTTCTCGAGAAATTGATCTCATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-242s21c1
Sequence:CCGGGCAGCTCCATCGGAGATTTAACTCGAGTTAAATCTCCGATGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-270s21c1
Sequence:CCGGAGTGGAGATCAGCCTACCATTCTCGAGAATGGTAGGCTGATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-428s21c1
Sequence:CCGGCCTGACCATCATGTCCTACTTCTCGAGAAGTAGGACATGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017899.2-549s21c1
Sequence:CCGGCGCATCACTCTGGAAGAATATCTCGAGATATTCTTCCAGAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-441s1c1
Sequence:CCGGCCTGGCTGATGAGATCAATTTCTCGAGAAATTGATCTCATCAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-471s1c1
Sequence:CCGGCCTGACCATCATGTCCTACTTCTCGAGAAGTAGGACATGATGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017899.1-313s1c1
Sequence:CCGGAGTGGAGATCAGCCTACCATTCTCGAGAATGGTAGGCTGATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-285s1c1
Sequence:CCGGGCAGCTCCATCGGAGATTTAACTCGAGTTAAATCTCCGATGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_017899.1-592s1c1
Sequence:CCGGCGCATCACTCTGGAAGAATATCTCGAGATATTCTTCCAGAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021344
TESC MISSION shRNA Bacterial Glycerol Stock
tescalcin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-703s1c1
Sequence:CCGGGATGCACATTCGTTTCCTCAACTCGAGTTGAGGAAACGAATGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-223s1c1
Sequence:CCGGGCCCACCATTCGCAAGGAGAACTCGAGTTCTCCTTGCGAATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-706s1c1
Sequence:CCGGGCACATTCGTTTCCTCAACATCTCGAGATGTTGAGGAAACGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-341s1c1
Sequence:CCGGCTGGCCGATGAGATCAACTTTCTCGAGAAAGTTGATCTCATCGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-443s1c1
Sequence:CCGGGAGAAGCTGAAATTTCTGTTTCTCGAGAAACAGAAATTTCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021344
TESC MISSION shRNA shRNA Plasmid DNA
tescalcin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-703s1c1
Sequence:CCGGGATGCACATTCGTTTCCTCAACTCGAGTTGAGGAAACGAATGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-223s1c1
Sequence:CCGGGCCCACCATTCGCAAGGAGAACTCGAGTTCTCCTTGCGAATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-706s1c1
Sequence:CCGGGCACATTCGTTTCCTCAACATCTCGAGATGTTGAGGAAACGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-341s1c1
Sequence:CCGGCTGGCCGATGAGATCAACTTTCTCGAGAAAGTTGATCTCATCGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-443s1c1
Sequence:CCGGGAGAAGCTGAAATTTCTGTTTCTCGAGAAACAGAAATTTCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021344
TESC MISSION shRNA Lentiviral Transduction Particles
tescalcin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-703s1c1
Sequence:CCGGGATGCACATTCGTTTCCTCAACTCGAGTTGAGGAAACGAATGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-223s1c1
Sequence:CCGGGCCCACCATTCGCAAGGAGAACTCGAGTTCTCCTTGCGAATGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-706s1c1
Sequence:CCGGGCACATTCGTTTCCTCAACATCTCGAGATGTTGAGGAAACGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-341s1c1
Sequence:CCGGCTGGCCGATGAGATCAACTTTCTCGAGAAAGTTGATCTCATCGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021344.2-443s1c1
Sequence:CCGGGAGAAGCTGAAATTTCTGTTTCTCGAGAAACAGAAATTTCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks