EMAIL THIS PAGE TO A FRIEND

TESK1

testis-specific kinase 1

UniProtKB ID: Q15569, Q8IXZ8
Gene ID:
Human(7016) Summary: This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain and a C-terminal proline-rich domain. Its protein kinase domain is most closely related to those of the LIM motif-containing protein kinases (LIMKs). The encoded protein can phosphorylate myelin basic protein and histone in vitro. The testicular germ cell-specific expression and developmental pattern of expression of the mouse gene suggests that this gene plays an important role at and after the meiotic phase of spermatogenesis. [provided by RefSeq, Jul 2008]
Mouse(21754) testis specific protein kinase 1
Rat(29460) testis-specific kinase 1
cow(527643) testis-specific kinase 1
sheep(101109153) testis-specific kinase 1
domestic guinea pig(100729085) testis-specific kinase 1
naked mole-rat(101723960) testis-specific kinase 1
chicken(429878) testis-specific kinase 1
Horse(100068022) testis-specific kinase 1
domestic cat(101086512) testis-specific kinase 1
dog(100688993) testis-specific kinase 1
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006285 siRNAs that have been validated in the lab human pricing
NM_031578 Rosetta Predictions rat pricing
XM_579517 Rosetta Predictions rat pricing
NM_011571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006285 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112965 validated 2057
2 SASI_Hs01_00112964 predicted 867
3 SASI_Hs01_00112966 predicted 2249
4 SASI_Hs01_00112968 predicted 1318
5 SASI_Hs01_00112969 predicted 2244
6 SASI_Hs01_00112970 predicted 710
7 SASI_Hs01_00112971 predicted 1042
8 SASI_Hs01_00112972 predicted 2098
9 SASI_Hs01_00112973 predicted 2260
10 SASI_Hs02_00341271 predicted 2102
11 SASI_Hs01_00112967 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037449 predicted 3317
2 SASI_Rn02_00264841 predicted 3206
3 SASI_Rn01_00037450 predicted 1624
4 SASI_Rn02_00264842 predicted 3061
5 SASI_Rn01_00037451 predicted 2471
6 SASI_Rn01_00037452 predicted 1945
7 SASI_Rn01_00037453 predicted 1901
8 SASI_Rn01_00037454 predicted 1601
9 SASI_Rn01_00037455 predicted 1621
10 SASI_Rn01_00037456 predicted 1487
11 SASI_Rn01_00037448 predicted 1702
12 SASI_Rn01_00037457 predicted 3336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579517 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125122 predicted 1195
2 SASI_Rn01_00125123 predicted 387
3 SASI_Rn01_00125124 predicted 473
4 SASI_Rn01_00125125 predicted 279
5 SASI_Rn01_00125126 predicted 1369
6 SASI_Rn01_00125127 predicted 995
7 SASI_Rn01_00125128 predicted 1508
8 SASI_Rn01_00125129 predicted 387
9 SASI_Rn01_00125130 predicted 1435
10 SASI_Rn01_00125131 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077668 predicted 3595
2 SASI_Mm01_00077669 predicted 3597
3 SASI_Mm01_00077670 predicted 3598
4 SASI_Mm01_00077671 predicted 2071
5 SASI_Mm01_00077672 predicted 2301
6 SASI_Mm01_00077673 predicted 2306
7 SASI_Mm01_00077674 predicted 1969
8 SASI_Mm02_00320954 predicted 1987
9 SASI_Mm01_00077675 predicted 2092
10 SASI_Mm01_00077676 predicted 1854
11 SASI_Mm01_00077677 predicted 2729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006285
TESK1 MISSION shRNA Bacterial Glycerol Stock
testis-specific kinase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-1474s1c1
Sequence:CCGGCCCTTCTCACTACGGGAAGACCTCGAGGTCTTCCCGTAGTGAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006285.2-2409s1c1
Sequence:CCGGCACTGAACCAGACACAGCATTCTCGAGAATGCTGTGTCTGGTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-576s1c1
Sequence:CCGGGCAAGTCATGGTGCTGAAGATCTCGAGATCTTCAGCACCATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006285.x-1747s1c1
Sequence:CCGGCAGACAACTTCATCAGCACCTCTCGAGAGGTGCTGATGAAGTTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006285.x-969s1c1
Sequence:CCGGCTGTATGATGAGAAGGCTGATCTCGAGATCAGCCTTCTCATCATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006285.x-987s1c1
Sequence:CCGGGATGTCTTTGCCTTCGGGATTCTCGAGAATCCCGAAGGCAAAGACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-1864s1c1
Sequence:CCGGTCAGGACCCGTCCTCAATAACCTCGAGGTTATTGAGGACGGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-832s1c1
Sequence:CCGGCTGCACTCCAAAGGTGTATTTCTCGAGAAATACACCTTTGGAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006285.2-2437s21c1
Sequence:CCGGCATGAGACTAACACGTGCAATCTCGAGATTGCACGTGTTAGTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-1864s21c1
Sequence:CCGGTCAGGACCCGTCCTCAATAACCTCGAGGTTATTGAGGACGGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-1118s21c1
Sequence:CCGGTACCACGCACTGAGGACTTTGCTCGAGCAAAGTCCTCAGTGCGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-1040s21c1
Sequence:CCGGATGAGAAGGCTGATGTCTTTGCTCGAGCAAAGACATCAGCCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-832s21c1
Sequence:CCGGCTGCACTCCAAAGGTGTATTTCTCGAGAAATACACCTTTGGAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006285
TESK1 MISSION shRNA shRNA Plasmid DNA
testis-specific kinase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-1474s1c1
Sequence:CCGGCCCTTCTCACTACGGGAAGACCTCGAGGTCTTCCCGTAGTGAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006285.2-2409s1c1
Sequence:CCGGCACTGAACCAGACACAGCATTCTCGAGAATGCTGTGTCTGGTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-576s1c1
Sequence:CCGGGCAAGTCATGGTGCTGAAGATCTCGAGATCTTCAGCACCATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006285.x-1747s1c1
Sequence:CCGGCAGACAACTTCATCAGCACCTCTCGAGAGGTGCTGATGAAGTTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006285.x-969s1c1
Sequence:CCGGCTGTATGATGAGAAGGCTGATCTCGAGATCAGCCTTCTCATCATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006285.x-987s1c1
Sequence:CCGGGATGTCTTTGCCTTCGGGATTCTCGAGAATCCCGAAGGCAAAGACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-1864s1c1
Sequence:CCGGTCAGGACCCGTCCTCAATAACCTCGAGGTTATTGAGGACGGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-832s1c1
Sequence:CCGGCTGCACTCCAAAGGTGTATTTCTCGAGAAATACACCTTTGGAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006285.2-2437s21c1
Sequence:CCGGCATGAGACTAACACGTGCAATCTCGAGATTGCACGTGTTAGTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-1864s21c1
Sequence:CCGGTCAGGACCCGTCCTCAATAACCTCGAGGTTATTGAGGACGGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-1118s21c1
Sequence:CCGGTACCACGCACTGAGGACTTTGCTCGAGCAAAGTCCTCAGTGCGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-1040s21c1
Sequence:CCGGATGAGAAGGCTGATGTCTTTGCTCGAGCAAAGACATCAGCCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-832s21c1
Sequence:CCGGCTGCACTCCAAAGGTGTATTTCTCGAGAAATACACCTTTGGAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006285
TESK1 MISSION shRNA Lentiviral Transduction Particles
testis-specific kinase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-1474s1c1
Sequence:CCGGCCCTTCTCACTACGGGAAGACCTCGAGGTCTTCCCGTAGTGAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195345    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006285.2-2409s1c1
Sequence:CCGGCACTGAACCAGACACAGCATTCTCGAGAATGCTGTGTCTGGTTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-576s1c1
Sequence:CCGGGCAAGTCATGGTGCTGAAGATCTCGAGATCTTCAGCACCATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006285.x-1747s1c1
Sequence:CCGGCAGACAACTTCATCAGCACCTCTCGAGAGGTGCTGATGAAGTTGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006285.x-969s1c1
Sequence:CCGGCTGTATGATGAGAAGGCTGATCTCGAGATCAGCCTTCTCATCATACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006285.x-987s1c1
Sequence:CCGGGATGTCTTTGCCTTCGGGATTCTCGAGAATCCCGAAGGCAAAGACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-1864s1c1
Sequence:CCGGTCAGGACCCGTCCTCAATAACCTCGAGGTTATTGAGGACGGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006285.2-832s1c1
Sequence:CCGGCTGCACTCCAAAGGTGTATTTCTCGAGAAATACACCTTTGGAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244958    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006285.2-2437s21c1
Sequence:CCGGCATGAGACTAACACGTGCAATCTCGAGATTGCACGTGTTAGTCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-1864s21c1
Sequence:CCGGTCAGGACCCGTCCTCAATAACCTCGAGGTTATTGAGGACGGGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-1118s21c1
Sequence:CCGGTACCACGCACTGAGGACTTTGCTCGAGCAAAGTCCTCAGTGCGTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-1040s21c1
Sequence:CCGGATGAGAAGGCTGATGTCTTTGCTCGAGCAAAGACATCAGCCTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006285.2-832s21c1
Sequence:CCGGCTGCACTCCAAAGGTGTATTTCTCGAGAAATACACCTTTGGAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011571
VALIDATED
TESK1 MISSION shRNA Bacterial Glycerol Stock
testis-specific kinase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011571.2-2079s1c1
Sequence:CCGGGCTGAGAAGATTCCTGTGTATCTCGAGATACACAGGAATCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011571.2-3222s1c1
Sequence:CCGGCCGTTCAGCTTTGGCTTTCTACTCGAGTAGAAAGCCAAAGCTGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011571.2-1859s1c1
Sequence:CCGGCGCGCTTACAGAGTATATGAACTCGAGTTCATATACTCTGTAAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011571.2-1676s1c1
Sequence:CCGGCGGTTTCTTCTCTGAGGTCTACTCGAGTAGACCTCAGAGAAGAAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-1741s21c1
Sequence:CCGGGCTGAGAAGATTCCTGTGTATCTCGAGATACACAGGAATCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-1519s21c1
Sequence:CCGGCACGCGCTTACAGAGTATATGCTCGAGCATATACTCTGTAAGCGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011571.3-3266s21c1
Sequence:CCGGGACTAACACGTGCAAAGTATTCTCGAGAATACTTTGCACGTGTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-1954s21c1
Sequence:CCGGGTGCCTGCTTTCCGAACTTTGCTCGAGCAAAGTTCGGAAAGCAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-2131s21c1
Sequence:CCGGACCAAGGCTCCCTTGACATACCTCGAGGTATGTCAAGGGAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011571
VALIDATED
TESK1 MISSION shRNA shRNA Plasmid DNA
testis-specific kinase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011571.2-2079s1c1
Sequence:CCGGGCTGAGAAGATTCCTGTGTATCTCGAGATACACAGGAATCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011571.2-3222s1c1
Sequence:CCGGCCGTTCAGCTTTGGCTTTCTACTCGAGTAGAAAGCCAAAGCTGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011571.2-1859s1c1
Sequence:CCGGCGCGCTTACAGAGTATATGAACTCGAGTTCATATACTCTGTAAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011571.2-1676s1c1
Sequence:CCGGCGGTTTCTTCTCTGAGGTCTACTCGAGTAGACCTCAGAGAAGAAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-1741s21c1
Sequence:CCGGGCTGAGAAGATTCCTGTGTATCTCGAGATACACAGGAATCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-1519s21c1
Sequence:CCGGCACGCGCTTACAGAGTATATGCTCGAGCATATACTCTGTAAGCGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011571.3-3266s21c1
Sequence:CCGGGACTAACACGTGCAAAGTATTCTCGAGAATACTTTGCACGTGTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-1954s21c1
Sequence:CCGGGTGCCTGCTTTCCGAACTTTGCTCGAGCAAAGTTCGGAAAGCAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-2131s21c1
Sequence:CCGGACCAAGGCTCCCTTGACATACCTCGAGGTATGTCAAGGGAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011571
VALIDATED
TESK1 MISSION shRNA Lentiviral Transduction Particles
testis-specific kinase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011571.2-2079s1c1
Sequence:CCGGGCTGAGAAGATTCCTGTGTATCTCGAGATACACAGGAATCTTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011571.2-3222s1c1
Sequence:CCGGCCGTTCAGCTTTGGCTTTCTACTCGAGTAGAAAGCCAAAGCTGAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011571.2-1859s1c1
Sequence:CCGGCGCGCTTACAGAGTATATGAACTCGAGTTCATATACTCTGTAAGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011571.2-1676s1c1
Sequence:CCGGCGGTTTCTTCTCTGAGGTCTACTCGAGTAGACCTCAGAGAAGAAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-1741s21c1
Sequence:CCGGGCTGAGAAGATTCCTGTGTATCTCGAGATACACAGGAATCTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-1519s21c1
Sequence:CCGGCACGCGCTTACAGAGTATATGCTCGAGCATATACTCTGTAAGCGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011571.3-3266s21c1
Sequence:CCGGGACTAACACGTGCAAAGTATTCTCGAGAATACTTTGCACGTGTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-1954s21c1
Sequence:CCGGGTGCCTGCTTTCCGAACTTTGCTCGAGCAAAGTTCGGAAAGCAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011571.3-2131s21c1
Sequence:CCGGACCAAGGCTCCCTTGACATACCTCGAGGTATGTCAAGGGAGCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks