EMAIL THIS PAGE TO A FRIEND

TESK2

testis-specific kinase 2

UniProtKB ID: Q96S53, Q5T422, Q5T423, Q8N520, Q9Y3Q6
Gene ID:
Human(10420) Summary: This gene product is a serine/threonine protein kinase that contains an N-terminal protein kinase domain that is structurally similar to the kinase domains of testis-specific protein kinase-1 and the LIM motif-containing protein kinases (LIMKs). Its overall structure is most related to the former, indicating that it belongs to the TESK subgroup of the LIMK/TESK family of protein kinases. This gene is predominantly expressed in testis and prostate. The developmental expression pattern of the rat gene in testis suggests an important role for this gene in meitoic stages and/or early stages of spermiogenesis. [provided by RefSeq, Jul 2008]
Mouse(230661) testis-specific kinase 2
Rat(170908) testis-specific kinase 2
Zebrafish(568213) testis-specific kinase 2
domestic cat(101090279) testis-specific kinase 2
Horse(100052478) testis-specific kinase 2
dog(608657) testis-specific kinase 2
chicken(424596) testis-specific kinase 2
naked mole-rat(101708559) testis-specific kinase 2
Domestic Rabbit(100343912) testis-specific kinase 2
domestic guinea pig(100735878) testis-specific kinase 2
cow(539979) testis-specific kinase 2
sheep(101111066) testis-specific kinase 2
Gene Class: Cytoskeleton
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007170 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007170 Rosetta Predictions human pricing
NM_133396 Rosetta Predictions rat pricing
NM_146151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129496 predicted 411
2 SASI_Hs01_00129498 predicted 1186
3 SASI_Hs01_00129499 predicted 933
4 SASI_Hs01_00129501 predicted 1863
5 SASI_Hs01_00129502 predicted 1121
6 SASI_Hs01_00129503 predicted 700
7 SASI_Hs01_00129504 predicted 1803
8 SASI_Hs02_00343105 predicted 1857
9 SASI_Hs01_00129505 predicted 1662
10 SASI_Hs02_00343106 predicted 1779
11 SASI_Hs01_00129497 predicted 728
12 SASI_Hs01_00129500 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133396 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069197 predicted 1042
2 SASI_Rn01_00069198 predicted 1248
3 SASI_Rn01_00069199 predicted 1145
4 SASI_Rn01_00069200 predicted 1334
5 SASI_Rn02_00267653 predicted 1035
6 SASI_Rn02_00267654 predicted 1233
7 SASI_Rn01_00069201 predicted 956
8 SASI_Rn01_00069202 predicted 1081
9 SASI_Rn01_00069203 predicted 894
10 SASI_Rn01_00069204 predicted 882
11 SASI_Rn01_00069205 predicted 734
12 SASI_Rn01_00069206 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114754 predicted 1360
2 SASI_Mm01_00114756 predicted 752
3 SASI_Mm02_00341838 predicted 987
4 SASI_Mm01_00114757 predicted 1252
5 SASI_Mm01_00114758 predicted 1117
6 SASI_Mm01_00114759 predicted 976
7 SASI_Mm01_00114760 predicted 1096
8 SASI_Mm01_00114761 predicted 381
9 SASI_Mm01_00114762 predicted 623
10 SASI_Mm01_00114763 predicted 1598
11 SASI_Mm01_00114755 predicted 1637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146151
TESK2 MISSION shRNA Bacterial Glycerol Stock
testis-specific kinase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-991s21c1
Sequence:CCGGAGATCCCTGACGCTAGTATAGCTCGAGCTATACTAGCGTCAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-504s21c1
Sequence:CCGGTCTTCATATCGTGCGATTATTCTCGAGAATAATCGCACGATATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-1449s21c1
Sequence:CCGGCCACGTCCAAGACGTACTATCCTCGAGGATAGTACGTCTTGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-1477s21c1
Sequence:CCGGCTCGAAGCCAGTCAGATATTTCTCGAGAAATATCTGACTGGCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-506s1c1
Sequence:CCGGCGTGCGATTATTAGTGCCTTTCTCGAGAAAGGCACTAATAATCGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-1235s1c1
Sequence:CCGGCTCACCTTTAACTGCTGTAATCTCGAGATTACAGCAGTTAAAGGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-1778s1c1
Sequence:CCGGTGTCCATTTATGGGCTGTGAACTCGAGTTCACAGCCCATAAATGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-1070s1c1
Sequence:CCGGCCTTATAATGAGAAGGCAGATCTCGAGATCTGCCTTCTCATTATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-670s1c1
Sequence:CCGGGCTGAAAGAGATGCAGCTCATCTCGAGATGAGCTGCATCTCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146151
TESK2 MISSION shRNA shRNA Plasmid DNA
testis-specific kinase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-991s21c1
Sequence:CCGGAGATCCCTGACGCTAGTATAGCTCGAGCTATACTAGCGTCAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-504s21c1
Sequence:CCGGTCTTCATATCGTGCGATTATTCTCGAGAATAATCGCACGATATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-1449s21c1
Sequence:CCGGCCACGTCCAAGACGTACTATCCTCGAGGATAGTACGTCTTGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-1477s21c1
Sequence:CCGGCTCGAAGCCAGTCAGATATTTCTCGAGAAATATCTGACTGGCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-506s1c1
Sequence:CCGGCGTGCGATTATTAGTGCCTTTCTCGAGAAAGGCACTAATAATCGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-1235s1c1
Sequence:CCGGCTCACCTTTAACTGCTGTAATCTCGAGATTACAGCAGTTAAAGGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-1778s1c1
Sequence:CCGGTGTCCATTTATGGGCTGTGAACTCGAGTTCACAGCCCATAAATGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-1070s1c1
Sequence:CCGGCCTTATAATGAGAAGGCAGATCTCGAGATCTGCCTTCTCATTATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-670s1c1
Sequence:CCGGGCTGAAAGAGATGCAGCTCATCTCGAGATGAGCTGCATCTCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146151
TESK2 MISSION shRNA Lentiviral Transduction Particles
testis-specific kinase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-991s21c1
Sequence:CCGGAGATCCCTGACGCTAGTATAGCTCGAGCTATACTAGCGTCAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-504s21c1
Sequence:CCGGTCTTCATATCGTGCGATTATTCTCGAGAATAATCGCACGATATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-1449s21c1
Sequence:CCGGCCACGTCCAAGACGTACTATCCTCGAGGATAGTACGTCTTGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146151.4-1477s21c1
Sequence:CCGGCTCGAAGCCAGTCAGATATTTCTCGAGAAATATCTGACTGGCTTCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-506s1c1
Sequence:CCGGCGTGCGATTATTAGTGCCTTTCTCGAGAAAGGCACTAATAATCGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-1235s1c1
Sequence:CCGGCTCACCTTTAACTGCTGTAATCTCGAGATTACAGCAGTTAAAGGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-1778s1c1
Sequence:CCGGTGTCCATTTATGGGCTGTGAACTCGAGTTCACAGCCCATAAATGGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-1070s1c1
Sequence:CCGGCCTTATAATGAGAAGGCAGATCTCGAGATCTGCCTTCTCATTATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146151.2-670s1c1
Sequence:CCGGGCTGAAAGAGATGCAGCTCATCTCGAGATGAGCTGCATCTCTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007170
VALIDATED
TESK2 MISSION shRNA Bacterial Glycerol Stock
testis-specific kinase 2
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-560s21c1
Sequence:CCGGCTGACGCGTTTGGATGATTTCCTCGAGGAAATCATCCAAACGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-892s21c1
Sequence:CCGGCCTCAGCTACCTTCACTTCAACTCGAGTTGAAGTGAAGGTAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-1878s21c1
Sequence:CCGGGAGTTAAAGAGATCCCACCATCTCGAGATGGTGGGATCTCTTTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-1783s21c1
Sequence:CCGGGCCTGAGTTCTTGCATCAAGACTCGAGTCTTGATGCAAGAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007170.2-2698s21c1
Sequence:CCGGGCTAACCTATTCAAAGACCTTCTCGAGAAGGTCTTTGAATAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-2640s1c1
Sequence:CCGGGCTAACCTATTCAAAGACCTTCTCGAGAAGGTCTTTGAATAGGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-722s1c1
Sequence:CCGGCCATCCCAACATCCTTAGGTACTCGAGTACCTAAGGATGTTGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-1822s1c1
Sequence:CCGGGAGTTAAAGAGATCCCACCATCTCGAGATGGTGGGATCTCTTTAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-836s1c1
Sequence:CCGGCCTCAGCTACCTTCACTTCAACTCGAGTTGAAGTGAAGGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-894s1c1
Sequence:CCGGCTGATAAAGAGGGATGAGAATCTCGAGATTCTCATCCCTCTTTATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.1-1727s1c1
Sequence:CCGGGCCTGAGTTCTTGCATCAAGACTCGAGTCTTGATGCAAGAACTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007170.1-2714s1c1
Sequence:CCGGCCATAAGACTTTCAACCTTGTCTCGAGACAAGGTTGAAAGTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.1-648s1c1
Sequence:CCGGGCTCTTAAGATGAACACATTGCTCGAGCAATGTGTTCATCTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007170.1-2346s1c1
Sequence:CCGGCCAGAGGATGTCTAGTTCTAGCTCGAGCTAGAACTAGACATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.1-552s1c1
Sequence:CCGGCTGACGCGTTTGGATGATTTCCTCGAGGAAATCATCCAAACGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007170
VALIDATED
TESK2 MISSION shRNA shRNA Plasmid DNA
testis-specific kinase 2
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-560s21c1
Sequence:CCGGCTGACGCGTTTGGATGATTTCCTCGAGGAAATCATCCAAACGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-892s21c1
Sequence:CCGGCCTCAGCTACCTTCACTTCAACTCGAGTTGAAGTGAAGGTAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-1878s21c1
Sequence:CCGGGAGTTAAAGAGATCCCACCATCTCGAGATGGTGGGATCTCTTTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-1783s21c1
Sequence:CCGGGCCTGAGTTCTTGCATCAAGACTCGAGTCTTGATGCAAGAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007170.2-2698s21c1
Sequence:CCGGGCTAACCTATTCAAAGACCTTCTCGAGAAGGTCTTTGAATAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-2640s1c1
Sequence:CCGGGCTAACCTATTCAAAGACCTTCTCGAGAAGGTCTTTGAATAGGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-722s1c1
Sequence:CCGGCCATCCCAACATCCTTAGGTACTCGAGTACCTAAGGATGTTGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-1822s1c1
Sequence:CCGGGAGTTAAAGAGATCCCACCATCTCGAGATGGTGGGATCTCTTTAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-836s1c1
Sequence:CCGGCCTCAGCTACCTTCACTTCAACTCGAGTTGAAGTGAAGGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-894s1c1
Sequence:CCGGCTGATAAAGAGGGATGAGAATCTCGAGATTCTCATCCCTCTTTATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.1-1727s1c1
Sequence:CCGGGCCTGAGTTCTTGCATCAAGACTCGAGTCTTGATGCAAGAACTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007170.1-2714s1c1
Sequence:CCGGCCATAAGACTTTCAACCTTGTCTCGAGACAAGGTTGAAAGTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.1-648s1c1
Sequence:CCGGGCTCTTAAGATGAACACATTGCTCGAGCAATGTGTTCATCTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007170.1-2346s1c1
Sequence:CCGGCCAGAGGATGTCTAGTTCTAGCTCGAGCTAGAACTAGACATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.1-552s1c1
Sequence:CCGGCTGACGCGTTTGGATGATTTCCTCGAGGAAATCATCCAAACGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007170
VALIDATED
TESK2 MISSION shRNA Lentiviral Transduction Particles
testis-specific kinase 2
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-560s21c1
Sequence:CCGGCTGACGCGTTTGGATGATTTCCTCGAGGAAATCATCCAAACGCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-892s21c1
Sequence:CCGGCCTCAGCTACCTTCACTTCAACTCGAGTTGAAGTGAAGGTAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-1878s21c1
Sequence:CCGGGAGTTAAAGAGATCCCACCATCTCGAGATGGTGGGATCTCTTTAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007170.2-1783s21c1
Sequence:CCGGGCCTGAGTTCTTGCATCAAGACTCGAGTCTTGATGCAAGAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277938    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007170.2-2698s21c1
Sequence:CCGGGCTAACCTATTCAAAGACCTTCTCGAGAAGGTCTTTGAATAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-2640s1c1
Sequence:CCGGGCTAACCTATTCAAAGACCTTCTCGAGAAGGTCTTTGAATAGGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-722s1c1
Sequence:CCGGCCATCCCAACATCCTTAGGTACTCGAGTACCTAAGGATGTTGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-1822s1c1
Sequence:CCGGGAGTTAAAGAGATCCCACCATCTCGAGATGGTGGGATCTCTTTAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-836s1c1
Sequence:CCGGCCTCAGCTACCTTCACTTCAACTCGAGTTGAAGTGAAGGTAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.x-894s1c1
Sequence:CCGGCTGATAAAGAGGGATGAGAATCTCGAGATTCTCATCCCTCTTTATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.1-1727s1c1
Sequence:CCGGGCCTGAGTTCTTGCATCAAGACTCGAGTCTTGATGCAAGAACTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195232    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007170.1-2714s1c1
Sequence:CCGGCCATAAGACTTTCAACCTTGTCTCGAGACAAGGTTGAAAGTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.1-648s1c1
Sequence:CCGGGCTCTTAAGATGAACACATTGCTCGAGCAATGTGTTCATCTTAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007170.1-2346s1c1
Sequence:CCGGCCAGAGGATGTCTAGTTCTAGCTCGAGCTAGAACTAGACATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007170.1-552s1c1
Sequence:CCGGCTGACGCGTTTGGATGATTTCCTCGAGGAAATCATCCAAACGCGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks