EMAIL THIS PAGE TO A FRIEND

TESPA1

thymocyte expressed, positive selection associated 1

Synonyms: KIAA0748
Gene ID:
Mouse(67596) thymocyte expressed, positive selection associated 1
domestic guinea pig(100722375) thymocyte expressed, positive selection associated 1
naked mole-rat(101707752) thymocyte expressed, positive selection associated 1
cow(538993) thymocyte expressed, positive selection associated 1
sheep(101120563) thymocyte expressed, positive selection associated 1
domestic cat(101080552) thymocyte expressed, positive selection associated 1
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183264 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183264 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183264 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001098815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098815 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098815 Rosetta Predictions human pricing
XM_374983 Rosetta Predictions human pricing
XM_934138 Rosetta Predictions human pricing
XM_934142 Rosetta Predictions human pricing
XM_934144 Rosetta Predictions human pricing
XM_934147 Rosetta Predictions human pricing
XM_934149 Rosetta Predictions human pricing
XM_934150 Rosetta Predictions human pricing
XM_934151 Rosetta Predictions human pricing
XM_934152 Rosetta Predictions human pricing
XM_934153 Rosetta Predictions human pricing
XM_934154 Rosetta Predictions human pricing
NM_183264 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320004 predicted 545
2 SASI_Hs02_00320005 predicted 858
3 SASI_Hs02_00320006 predicted 688
4 SASI_Hs02_00320007 predicted 1654
5 SASI_Hs02_00320008 predicted 1525
6 SASI_Hs02_00320009 predicted 478
7 SASI_Hs02_00320010 predicted 559
8 SASI_Hs02_00320011 predicted 350
9 SASI_Hs02_00320012 predicted 630
10 SASI_Hs02_00320013 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295301 predicted 1107
2 SASI_Hs01_00295302 predicted 1305
3 SASI_Hs01_00295303 predicted 1292
4 SASI_Hs01_00295304 predicted 1671
5 SASI_Hs01_00295305 predicted 1513
6 SASI_Hs01_00295306 predicted 1366
7 SASI_Hs01_00295307 predicted 1465
8 SASI_Hs01_00295308 predicted 1065
9 SASI_Hs01_00295309 predicted 1311
10 SASI_Hs01_00295310 predicted 1314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287383 predicted 499
2 SASI_Hs01_00287384 predicted 698
3 SASI_Hs01_00287385 predicted 679
4 SASI_Hs01_00287386 predicted 1054
5 SASI_Hs01_00287387 predicted 896
6 SASI_Hs01_00287388 predicted 758
7 SASI_Hs01_00287389 predicted 858
8 SASI_Hs01_00287390 predicted 453
9 SASI_Hs01_00287391 predicted 707
10 SASI_Hs01_00287392 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269144 predicted 815
2 SASI_Hs01_00269145 predicted 1010
3 SASI_Hs01_00269146 predicted 992
4 SASI_Hs01_00269147 predicted 1378
5 SASI_Hs01_00269148 predicted 1214
6 SASI_Hs01_00269149 predicted 1070
7 SASI_Hs01_00269150 predicted 1175
8 SASI_Hs01_00269151 predicted 778
9 SASI_Hs01_00269152 predicted 1017
10 SASI_Hs01_00269153 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257673 predicted 625
2 SASI_Hs01_00257674 predicted 822
3 SASI_Hs01_00257675 predicted 803
4 SASI_Hs01_00257676 predicted 1190
5 SASI_Hs01_00257677 predicted 1022
6 SASI_Hs01_00257678 predicted 885
7 SASI_Hs01_00257679 predicted 989
8 SASI_Hs01_00257680 predicted 584
9 SASI_Hs01_00257681 predicted 826
10 SASI_Hs01_00257682 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282829 predicted 782
2 SASI_Hs01_00282830 predicted 977
3 SASI_Hs01_00282831 predicted 959
4 SASI_Hs01_00282832 predicted 1331
5 SASI_Hs01_00282833 predicted 1171
6 SASI_Hs01_00282834 predicted 1031
7 SASI_Hs01_00282835 predicted 1135
8 SASI_Hs01_00282836 predicted 737
9 SASI_Hs01_00282837 predicted 976
10 SASI_Hs01_00282838 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00273943 predicted 776
2 SASI_Hs01_00273944 predicted 765
3 SASI_Hs01_00273945 predicted 636
4 SASI_Hs01_00273946 predicted 1347
5 SASI_Hs01_00273947 predicted 728
6 SASI_Hs01_00273948 predicted 723
7 SASI_Hs01_00273949 predicted 676
8 SASI_Hs01_00273950 predicted 723
9 SASI_Hs01_00273951 predicted 1364
10 SASI_Hs01_00273952 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289764 predicted 1273
2 SASI_Hs01_00289765 predicted 1292
3 SASI_Hs01_00289766 predicted 1137
4 SASI_Hs01_00289767 predicted 1091
5 SASI_Hs01_00289768 predicted 1331
6 SASI_Hs01_00289769 predicted 1310
7 SASI_Hs01_00289770 predicted 1096
8 SASI_Hs01_00289771 predicted 1204
9 SASI_Hs01_00289772 predicted 1268
10 SASI_Hs01_00289773 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300662 predicted 1078
2 SASI_Hs01_00300663 predicted 1091
3 SASI_Hs01_00300664 predicted 935
4 SASI_Hs01_00300665 predicted 1126
5 SASI_Hs01_00300666 predicted 889
6 SASI_Hs01_00300667 predicted 1022
7 SASI_Hs01_00300668 predicted 1132
8 SASI_Hs01_00300669 predicted 1109
9 SASI_Hs01_00300670 predicted 1059
10 SASI_Hs01_00300671 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279258 predicted 1071
2 SASI_Hs01_00279259 predicted 929
3 SASI_Hs01_00279260 predicted 669
4 SASI_Hs01_00279261 predicted 1106
5 SASI_Hs01_00279262 predicted 1072
6 SASI_Hs01_00279263 predicted 812
7 SASI_Hs01_00279264 predicted 673
8 SASI_Hs01_00279265 predicted 1028
9 SASI_Hs01_00279266 predicted 869
10 SASI_Hs01_00279267 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266525 predicted 1127
2 SASI_Hs01_00266526 predicted 1139
3 SASI_Hs01_00266527 predicted 979
4 SASI_Hs01_00266528 predicted 941
5 SASI_Hs01_00266529 predicted 1180
6 SASI_Hs01_00266530 predicted 1162
7 SASI_Hs01_00266531 predicted 947
8 SASI_Hs01_00266532 predicted 1049
9 SASI_Hs01_00266533 predicted 1117
10 SASI_Hs01_00266534 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259912 predicted 1125
2 SASI_Hs01_00259913 predicted 1137
3 SASI_Hs01_00259914 predicted 983
4 SASI_Hs01_00259915 predicted 939
5 SASI_Hs01_00259916 predicted 1177
6 SASI_Hs01_00259917 predicted 1162
7 SASI_Hs01_00259918 predicted 949
8 SASI_Hs01_00259919 predicted 1058
9 SASI_Hs01_00259920 predicted 1114
10 SASI_Hs01_00259921 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183264 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350354 predicted 476
2 SASI_Mm01_00081151 predicted 681
3 SASI_Mm01_00081153 predicted 922
4 SASI_Mm01_00081155 predicted 1383
5 SASI_Mm01_00081156 predicted 1261
6 SASI_Mm01_00081159 predicted 1349
7 SASI_Mm02_00350355 predicted 1030
8 SASI_Mm02_00350356 predicted 1313
9 SASI_Mm02_00350357 predicted 293
10 SASI_Mm02_00350358 predicted 217
11 SASI_Mm01_00081150 predicted 801
12 SASI_Mm01_00081152 predicted 882
13 SASI_Mm01_00081154 predicted 360
14 SASI_Mm01_00081157 predicted 837
15 SASI_Mm01_00081158 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183264
TESPA1 MISSION shRNA Bacterial Glycerol Stock
thymocyte expressed, positive selection associated 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.1-429s1c1
Sequence:CCGGCCACAAAGACACATCTCGTATCTCGAGATACGAGATGTGTCTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.1-658s1c1
Sequence:CCGGCCATCCAACATGTTCTGGAATCTCGAGATTCCAGAACATGTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-1301s21c1
Sequence:CCGGCAGGTCCACAGTACCACATAACTCGAGTTATGTGGTACTGTGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-411s21c1
Sequence:CCGGATCTAACTACAGTGGATATTCCTCGAGGAATATCCACTGTAGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.4-397s1c1
Sequence:CCGGGAAGAATCAGGGCAATCTAACCTCGAGGTTAGATTGCCCTGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.4-1347s1c1
Sequence:CCGGGTGGGTTCTACAGGACATTAACTCGAGTTAATGTCCTGTAGAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.4-1057s1c1
Sequence:CCGGGATCGGCTATCATCATCTTACCTCGAGGTAAGATGATGATAGCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-703s21c1
Sequence:CCGGTCTCGTATCCCTGCAAGATTTCTCGAGAAATCTTGCAGGGATACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-1518s21c1
Sequence:CCGGACATGAGCTGACCAATCTTTACTCGAGTAAAGATTGGTCAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000266835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-550s21c1
Sequence:CCGGCTTGATCTTGGCTCTAGTTTGCTCGAGCAAACTAGAGCCAAGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183264
TESPA1 MISSION shRNA shRNA Plasmid DNA
thymocyte expressed, positive selection associated 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.1-429s1c1
Sequence:CCGGCCACAAAGACACATCTCGTATCTCGAGATACGAGATGTGTCTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.1-658s1c1
Sequence:CCGGCCATCCAACATGTTCTGGAATCTCGAGATTCCAGAACATGTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-1301s21c1
Sequence:CCGGCAGGTCCACAGTACCACATAACTCGAGTTATGTGGTACTGTGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-411s21c1
Sequence:CCGGATCTAACTACAGTGGATATTCCTCGAGGAATATCCACTGTAGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.4-397s1c1
Sequence:CCGGGAAGAATCAGGGCAATCTAACCTCGAGGTTAGATTGCCCTGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.4-1347s1c1
Sequence:CCGGGTGGGTTCTACAGGACATTAACTCGAGTTAATGTCCTGTAGAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.4-1057s1c1
Sequence:CCGGGATCGGCTATCATCATCTTACCTCGAGGTAAGATGATGATAGCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-703s21c1
Sequence:CCGGTCTCGTATCCCTGCAAGATTTCTCGAGAAATCTTGCAGGGATACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-1518s21c1
Sequence:CCGGACATGAGCTGACCAATCTTTACTCGAGTAAAGATTGGTCAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000266835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-550s21c1
Sequence:CCGGCTTGATCTTGGCTCTAGTTTGCTCGAGCAAACTAGAGCCAAGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183264
TESPA1 MISSION shRNA Lentiviral Transduction Particles
thymocyte expressed, positive selection associated 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179914    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.1-429s1c1
Sequence:CCGGCCACAAAGACACATCTCGTATCTCGAGATACGAGATGTGTCTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.1-658s1c1
Sequence:CCGGCCATCCAACATGTTCTGGAATCTCGAGATTCCAGAACATGTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-1301s21c1
Sequence:CCGGCAGGTCCACAGTACCACATAACTCGAGTTATGTGGTACTGTGGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-411s21c1
Sequence:CCGGATCTAACTACAGTGGATATTCCTCGAGGAATATCCACTGTAGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.4-397s1c1
Sequence:CCGGGAAGAATCAGGGCAATCTAACCTCGAGGTTAGATTGCCCTGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.4-1347s1c1
Sequence:CCGGGTGGGTTCTACAGGACATTAACTCGAGTTAATGTCCTGTAGAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_183264.4-1057s1c1
Sequence:CCGGGATCGGCTATCATCATCTTACCTCGAGGTAAGATGATGATAGCCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-703s21c1
Sequence:CCGGTCTCGTATCCCTGCAAGATTTCTCGAGAAATCTTGCAGGGATACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-1518s21c1
Sequence:CCGGACATGAGCTGACCAATCTTTACTCGAGTAAAGATTGGTCAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000266835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183264.4-550s21c1
Sequence:CCGGCTTGATCTTGGCTCTAGTTTGCTCGAGCAAACTAGAGCCAAGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098815
TESPA1 MISSION shRNA Bacterial Glycerol Stock
thymocyte expressed, positive selection associated 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-719s21c1
Sequence:CCGGCCAGGTGCGGAGGATTGAAATCTCGAGATTTCAATCCTCCGCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-270s21c1
Sequence:CCGGGAAGGGAATCCAATCAATAAACTCGAGTTTATTGATTGGATTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098815.1-1699s21c1
Sequence:CCGGGCATGTGGTCTGACAGAATTGCTCGAGCAATTCTGTCAGACCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-1057s21c1
Sequence:CCGGTGTTGGAAGTGATGGACAAAGCTCGAGCTTTGTCCATCACTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-1521s21c1
Sequence:CCGGCCAGAACTGCGTCGGTCTTTACTCGAGTAAAGACCGACGCAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098815
TESPA1 MISSION shRNA shRNA Plasmid DNA
thymocyte expressed, positive selection associated 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-719s21c1
Sequence:CCGGCCAGGTGCGGAGGATTGAAATCTCGAGATTTCAATCCTCCGCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-270s21c1
Sequence:CCGGGAAGGGAATCCAATCAATAAACTCGAGTTTATTGATTGGATTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098815.1-1699s21c1
Sequence:CCGGGCATGTGGTCTGACAGAATTGCTCGAGCAATTCTGTCAGACCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-1057s21c1
Sequence:CCGGTGTTGGAAGTGATGGACAAAGCTCGAGCTTTGTCCATCACTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-1521s21c1
Sequence:CCGGCCAGAACTGCGTCGGTCTTTACTCGAGTAAAGACCGACGCAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098815
TESPA1 MISSION shRNA Lentiviral Transduction Particles
thymocyte expressed, positive selection associated 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-719s21c1
Sequence:CCGGCCAGGTGCGGAGGATTGAAATCTCGAGATTTCAATCCTCCGCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-270s21c1
Sequence:CCGGGAAGGGAATCCAATCAATAAACTCGAGTTTATTGATTGGATTCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098815.1-1699s21c1
Sequence:CCGGGCATGTGGTCTGACAGAATTGCTCGAGCAATTCTGTCAGACCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-1057s21c1
Sequence:CCGGTGTTGGAAGTGATGGACAAAGCTCGAGCTTTGTCCATCACTTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098815.1-1521s21c1
Sequence:CCGGCCAGAACTGCGTCGGTCTTTACTCGAGTAAAGACCGACGCAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks