EMAIL THIS PAGE TO A FRIEND

TET1

tet methylcytosine dioxygenase 1

Synonyms: CXXC6 LCX bA119F7.1
UniProtKB ID: Q8NFU7, Q5VUP7, Q7Z6B6, Q8TCR1, Q9C0I7
Gene ID:
Mouse(52463) tet methylcytosine dioxygenase 1
Rat(309902) tet methylcytosine dioxygenase 1
cow(513640) tet methylcytosine dioxygenase 1
sheep(101103534) tet methylcytosine dioxygenase 1
domestic guinea pig(100718966) tet methylcytosine dioxygenase 1
naked mole-rat(101703231) tet methylcytosine dioxygenase 1
chicken(423690) tet oncogene 1
dog(479229) tet methylcytosine dioxygenase 1
domestic cat(101091562) tet methylcytosine dioxygenase 1
167 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030625 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030625 Rosetta Predictions human pricing
NM_001107643 Rosetta Predictions rat pricing
XM_125673 Rosetta Predictions mouse pricing
XM_907080 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168428 predicted 814
2 SASI_Hs01_00168429 predicted 2652
3 SASI_Hs01_00168430 predicted 6759
4 SASI_Hs01_00168431 predicted 3630
5 SASI_Hs02_00358183 predicted 3277
6 SASI_Hs02_00358184 predicted 5874
7 SASI_Hs01_00168433 predicted 3179
8 SASI_Hs02_00358185 predicted 6802
9 SASI_Hs01_00168435 predicted 5386
10 SASI_Hs01_00168436 predicted 4507
11 SASI_Hs01_00168432 predicted 2731
12 SASI_Hs01_00168434 predicted 4865
13 SASI_Hs01_00168437 predicted 4655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230855 predicted 508
2 SASI_Rn02_00230856 predicted 941
3 SASI_Rn02_00230857 predicted 243
4 SASI_Rn02_00230858 predicted 278
5 SASI_Rn02_00230859 predicted 553
6 SASI_Rn02_00230860 predicted 702
7 SASI_Rn02_00230861 predicted 1332
8 SASI_Rn02_00230862 predicted 1954
9 SASI_Rn02_00230863 predicted 1986
10 SASI_Rn02_00230864 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231866 predicted 3917
2 SASI_Mm01_00231868 predicted 248
3 SASI_Mm01_00231869 predicted 4229
4 SASI_Mm02_00424101 predicted 5579
5 SASI_Mm01_00231870 predicted 3767
6 SASI_Mm01_00231871 predicted 3105
7 SASI_Mm02_00424102 predicted 580
8 SASI_Mm01_00231872 predicted 280
9 SASI_Mm01_00231873 predicted 4703
10 SASI_Mm01_00231875 predicted 2607
11 SASI_Mm01_00231867 predicted 656
12 SASI_Mm01_00231874 predicted 2037
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433031 predicted 3923
2 SASI_Mm02_00433032 predicted 241
3 SASI_Mm02_00433033 predicted 4231
4 SASI_Mm02_00433034 predicted 5579
5 SASI_Mm02_00433035 predicted 3768
6 SASI_Mm02_00433036 predicted 3108
7 SASI_Mm02_00433037 predicted 582
8 SASI_Mm02_00433038 predicted 274
9 SASI_Mm02_00433039 predicted 4705
10 SASI_Mm02_00433040 predicted 2606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030625
VALIDATED
TET1 MISSION shRNA Bacterial Glycerol Stock
tet methylcytosine dioxygenase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030625.2-2406s21c1
Sequence:CCGGTTGTGCCTCTGGAGGTTATAACTCGAGTTATAACCTCCAGAGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030625.2-3749s21c1
Sequence:CCGGACACAACTTGCTTCGATAATTCTCGAGAATTATCGAAGCAAGTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030625.1-6882s1c1
Sequence:CCGGCCTTGATAGAATCACTCAGTTCTCGAGAACTGAGTGATTCTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030625.1-6468s1c1
Sequence:CCGGGCAGCTAATGAAGGTCCAGAACTCGAGTTCTGGACCTTCATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030625.1-4995s1c1
Sequence:CCGGCCCAGAAGATTTAGAATTGATCTCGAGATCAATTCTAAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030625.1-3748s1c1
Sequence:CCGGCCTATATGTATGGCACAATATCTCGAGATATTGTGCCATACATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030625.1-1105s1c1
Sequence:CCGGCCTCCAGTCTTAATAAGGTTACTCGAGTAACCTTATTAAGACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030625
VALIDATED
TET1 MISSION shRNA shRNA Plasmid DNA
tet methylcytosine dioxygenase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030625.2-2406s21c1
Sequence:CCGGTTGTGCCTCTGGAGGTTATAACTCGAGTTATAACCTCCAGAGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030625.2-3749s21c1
Sequence:CCGGACACAACTTGCTTCGATAATTCTCGAGAATTATCGAAGCAAGTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030625.1-6882s1c1
Sequence:CCGGCCTTGATAGAATCACTCAGTTCTCGAGAACTGAGTGATTCTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030625.1-6468s1c1
Sequence:CCGGGCAGCTAATGAAGGTCCAGAACTCGAGTTCTGGACCTTCATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030625.1-4995s1c1
Sequence:CCGGCCCAGAAGATTTAGAATTGATCTCGAGATCAATTCTAAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030625.1-3748s1c1
Sequence:CCGGCCTATATGTATGGCACAATATCTCGAGATATTGTGCCATACATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030625.1-1105s1c1
Sequence:CCGGCCTCCAGTCTTAATAAGGTTACTCGAGTAACCTTATTAAGACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030625
VALIDATED
TET1 MISSION shRNA Lentiviral Transduction Particles
tet methylcytosine dioxygenase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030625.2-2406s21c1
Sequence:CCGGTTGTGCCTCTGGAGGTTATAACTCGAGTTATAACCTCCAGAGGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030625.2-3749s21c1
Sequence:CCGGACACAACTTGCTTCGATAATTCTCGAGAATTATCGAAGCAAGTTGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030625.1-6882s1c1
Sequence:CCGGCCTTGATAGAATCACTCAGTTCTCGAGAACTGAGTGATTCTATCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030625.1-6468s1c1
Sequence:CCGGGCAGCTAATGAAGGTCCAGAACTCGAGTTCTGGACCTTCATTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030625.1-4995s1c1
Sequence:CCGGCCCAGAAGATTTAGAATTGATCTCGAGATCAATTCTAAATCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030625.1-3748s1c1
Sequence:CCGGCCTATATGTATGGCACAATATCTCGAGATATTGTGCCATACATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_030625.1-1105s1c1
Sequence:CCGGCCTCCAGTCTTAATAAGGTTACTCGAGTAACCTTATTAAGACTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027384
TET1 MISSION shRNA Bacterial Glycerol Stock
tet methylcytosine dioxygenase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-826s21c1
Sequence:CCGGCCTACGGGAAGCGACCATAATCTCGAGATTATGGTCGCTTCCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-3391s21c1
Sequence:CCGGCTAGCTATAGAGTATAGTAAACTCGAGTTTACTATACTCTATAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027384.1-6168s21c1
Sequence:CCGGTTTCAACTCCGACGTAAATATCTCGAGATATTTACGTCGGAGTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-3112s21c1
Sequence:CCGGCAACTTGCATCCACGATTAATCTCGAGATTAATCGTGGATGCAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-3769s21c1
Sequence:CCGGTCTAACCAGTGTGCTAATATACTCGAGTATATTAGCACACTGGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027384
TET1 MISSION shRNA shRNA Plasmid DNA
tet methylcytosine dioxygenase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-826s21c1
Sequence:CCGGCCTACGGGAAGCGACCATAATCTCGAGATTATGGTCGCTTCCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-3391s21c1
Sequence:CCGGCTAGCTATAGAGTATAGTAAACTCGAGTTTACTATACTCTATAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027384.1-6168s21c1
Sequence:CCGGTTTCAACTCCGACGTAAATATCTCGAGATATTTACGTCGGAGTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-3112s21c1
Sequence:CCGGCAACTTGCATCCACGATTAATCTCGAGATTAATCGTGGATGCAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-3769s21c1
Sequence:CCGGTCTAACCAGTGTGCTAATATACTCGAGTATATTAGCACACTGGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027384
TET1 MISSION shRNA Lentiviral Transduction Particles
tet methylcytosine dioxygenase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-826s21c1
Sequence:CCGGCCTACGGGAAGCGACCATAATCTCGAGATTATGGTCGCTTCCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-3391s21c1
Sequence:CCGGCTAGCTATAGAGTATAGTAAACTCGAGTTTACTATACTCTATAGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027384.1-6168s21c1
Sequence:CCGGTTTCAACTCCGACGTAAATATCTCGAGATATTTACGTCGGAGTTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-3112s21c1
Sequence:CCGGCAACTTGCATCCACGATTAATCTCGAGATTAATCGTGGATGCAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027384.1-3769s21c1
Sequence:CCGGTCTAACCAGTGTGCTAATATACTCGAGTATATTAGCACACTGGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks