EMAIL THIS PAGE TO A FRIEND

TET2

tet methylcytosine dioxygenase 2

Synonyms: KIAA1546 MDS
Gene ID:
Human(54790) Summary: The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(214133) tet methylcytosine dioxygenase 2
Rat(310859) tet methylcytosine dioxygenase 2
Thale Cress(816477) tetraspanin2
dog(478499) tet methylcytosine dioxygenase 2
Horse(100073065) tet methylcytosine dioxygenase 2
domestic cat(101092848) tet methylcytosine dioxygenase 2
chicken(422540) tet methylcytosine dioxygenase 2
Zebrafish(492374) tet methylcytosine dioxygenase 2
naked mole-rat(101722412) tet methylcytosine dioxygenase 2
Domestic Rabbit(100339579) tet methylcytosine dioxygenase 2
domestic guinea pig(100733403) tet methylcytosine dioxygenase 2
cow(538481) tet methylcytosine dioxygenase 2
sheep(101104996) tet methylcytosine dioxygenase 2
269 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145989 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145989 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145989 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017628 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001040400 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001040400 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001040400 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127208 Rosetta Predictions human pricing
NM_017628 Rosetta Predictions human pricing
XM_001077411 Rosetta Predictions rat pricing
XM_227694 Rosetta Predictions rat pricing
NM_001040400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328772 predicted 2701
2 SASI_Hs02_00328773 predicted 1844
3 SASI_Hs02_00328774 predicted 1006
4 SASI_Hs02_00328775 predicted 1133
5 SASI_Hs02_00328776 predicted 1909
6 SASI_Hs02_00328777 predicted 1736
7 SASI_Hs02_00328778 predicted 1285
8 SASI_Hs02_00328779 predicted 732
9 SASI_Hs02_00328780 predicted 1526
10 SASI_Hs02_00328781 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350302 predicted 2697
2 SASI_Hs02_00350303 predicted 1848
3 SASI_Hs01_00214141 predicted 999
4 SASI_Hs01_00214142 predicted 1133
5 SASI_Hs02_00350304 predicted 1911
6 SASI_Hs01_00214143 predicted 1736
7 SASI_Hs01_00214144 predicted 1278
8 SASI_Hs01_00214145 predicted 728
9 SASI_Hs01_00214147 predicted 1525
10 SASI_Hs02_00350305 predicted 1119
11 SASI_Hs01_00214146 predicted 2494
12 SASI_Hs01_00214148 predicted 3760
13 SASI_Hs01_00214149 predicted 1227
14 SASI_Hs01_00214150 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00356965 predicted 4304
2 SASI_Rn02_00356966 predicted 586
3 SASI_Rn02_00356967 predicted 1345
4 SASI_Rn02_00356968 predicted 493
5 SASI_Rn02_00356969 predicted 3397
6 SASI_Rn02_00356970 predicted 4658
7 SASI_Rn02_00356971 predicted 2025
8 SASI_Rn02_00356972 predicted 3434
9 SASI_Rn02_00356973 predicted 869
10 SASI_Rn02_00356974 predicted 5486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384635 predicted 582
2 SASI_Rn02_00384636 predicted 494
3 SASI_Rn02_00384637 predicted 978
4 SASI_Rn02_00384638 predicted 1303
5 SASI_Rn02_00384639 predicted 872
6 SASI_Rn02_00384640 predicted 295
7 SASI_Rn02_00384641 predicted 762
8 SASI_Rn02_00384642 predicted 311
9 SASI_Rn02_00384643 predicted 581
10 SASI_Rn02_00384644 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290314 predicted 964
2 SASI_Mm01_00121912 predicted 5123
3 SASI_Mm01_00121913 predicted 2709
4 SASI_Mm01_00121914 predicted 5662
5 SASI_Mm01_00121915 predicted 4114
6 SASI_Mm01_00121917 predicted 3174
7 SASI_Mm01_00121918 predicted 4806
8 SASI_Mm01_00121919 predicted 5715
9 SASI_Mm02_00290315 predicted 605
10 SASI_Mm01_00121920 predicted 3689
11 SASI_Mm01_00121916 predicted 3911
12 SASI_Mm01_00121921 predicted 5704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145989
TET2 MISSION shRNA Bacterial Glycerol Stock
tet methylcytosine dioxygenase 2
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000201087    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145989.1-2541s1c1
Sequence:CCGGCGCTGGACATTTGTCTTGAAACTCGAGTTTCAAGACAAATGTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145989.1-1895s1c1
Sequence:CCGGCCAACTCATGGGTCAATTCTTCTCGAGAAGAATTGACCCATGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145989
TET2 MISSION shRNA shRNA Plasmid DNA
tet methylcytosine dioxygenase 2
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000201087    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145989.1-2541s1c1
Sequence:CCGGCGCTGGACATTTGTCTTGAAACTCGAGTTTCAAGACAAATGTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145989.1-1895s1c1
Sequence:CCGGCCAACTCATGGGTCAATTCTTCTCGAGAAGAATTGACCCATGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145989
TET2 MISSION shRNA Lentiviral Transduction Particles
tet methylcytosine dioxygenase 2
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000201087    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145989.1-2541s1c1
Sequence:CCGGCGCTGGACATTTGTCTTGAAACTCGAGTTTCAAGACAAATGTCCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145989.1-1895s1c1
Sequence:CCGGCCAACTCATGGGTCAATTCTTCTCGAGAAGAATTGACCCATGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017628
TET2 MISSION shRNA Bacterial Glycerol Stock
tet methylcytosine dioxygenase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-3514s1c1
Sequence:CCGGGCCAAGTCATTATTTGACCATCTCGAGATGGTCAAATAATGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-2857s1c1
Sequence:CCGGCCTTATAGTCAGACCATGAAACTCGAGTTTCATGGTCTGACTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-1938s1c1
Sequence:CCGGCCTCAAGCATAACCCACCAATCTCGAGATTGGTGGGTTATGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-3845s1c1
Sequence:CCGGGCGTTTATCCAGAATTAGCAACTCGAGTTGCTAATTCTGGATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017628.3-4176s21c1
Sequence:CCGGCAGTCTAATGTACGAACTTTACTCGAGTAAAGTTCGTACATTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017628.3-3312s21c1
Sequence:CCGGCAGATGCACAGGCCAATTAAGCTCGAGCTTAATTGGCCTGTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017628.3-3489s21c1
Sequence:CCGGTTTCACGCCAAGTCGTTATTTCTCGAGAAATAACGACTTGGCGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017628
TET2 MISSION shRNA shRNA Plasmid DNA
tet methylcytosine dioxygenase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-3514s1c1
Sequence:CCGGGCCAAGTCATTATTTGACCATCTCGAGATGGTCAAATAATGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-2857s1c1
Sequence:CCGGCCTTATAGTCAGACCATGAAACTCGAGTTTCATGGTCTGACTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-1938s1c1
Sequence:CCGGCCTCAAGCATAACCCACCAATCTCGAGATTGGTGGGTTATGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-3845s1c1
Sequence:CCGGGCGTTTATCCAGAATTAGCAACTCGAGTTGCTAATTCTGGATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017628.3-4176s21c1
Sequence:CCGGCAGTCTAATGTACGAACTTTACTCGAGTAAAGTTCGTACATTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017628.3-3312s21c1
Sequence:CCGGCAGATGCACAGGCCAATTAAGCTCGAGCTTAATTGGCCTGTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017628.3-3489s21c1
Sequence:CCGGTTTCACGCCAAGTCGTTATTTCTCGAGAAATAACGACTTGGCGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017628
TET2 MISSION shRNA Lentiviral Transduction Particles
tet methylcytosine dioxygenase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-3514s1c1
Sequence:CCGGGCCAAGTCATTATTTGACCATCTCGAGATGGTCAAATAATGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-2857s1c1
Sequence:CCGGCCTTATAGTCAGACCATGAAACTCGAGTTTCATGGTCTGACTATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-1938s1c1
Sequence:CCGGCCTCAAGCATAACCCACCAATCTCGAGATTGGTGGGTTATGCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017628.2-3845s1c1
Sequence:CCGGGCGTTTATCCAGAATTAGCAACTCGAGTTGCTAATTCTGGATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017628.3-4176s21c1
Sequence:CCGGCAGTCTAATGTACGAACTTTACTCGAGTAAAGTTCGTACATTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017628.3-3312s21c1
Sequence:CCGGCAGATGCACAGGCCAATTAAGCTCGAGCTTAATTGGCCTGTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017628.3-3489s21c1
Sequence:CCGGTTTCACGCCAAGTCGTTATTTCTCGAGAAATAACGACTTGGCGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040400
TET2 MISSION shRNA Bacterial Glycerol Stock
tet methylcytosine dioxygenase 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-2290s21c1
Sequence:CCGGGAGCGTTCCTCAGTATCATTTCTCGAGAAATGATACTGAGGAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-2819s21c1
Sequence:CCGGATGCAGTATTTCCCGAATAATCTCGAGATTATTCGGGAAATACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001040400.2-5819s1c1
Sequence:CCGGCTTGTACTGTATAGGCATAAGCTCGAGCTTATGCCTATACAGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-4470s21c1
Sequence:CCGGTTCGGAGGAGAAGGGTCATAACTCGAGTTATGACCCTTCTCCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-2558s21c1
Sequence:CCGGTCGTGCTTTGGCCAGATTAAACTCGAGTTTAATCTGGCCAAAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040400.2-6858s21c1
Sequence:CCGGATGTCCTTGTAGGACTATAATCTCGAGATTATAGTCCTACAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040400
TET2 MISSION shRNA shRNA Plasmid DNA
tet methylcytosine dioxygenase 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-2290s21c1
Sequence:CCGGGAGCGTTCCTCAGTATCATTTCTCGAGAAATGATACTGAGGAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-2819s21c1
Sequence:CCGGATGCAGTATTTCCCGAATAATCTCGAGATTATTCGGGAAATACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001040400.2-5819s1c1
Sequence:CCGGCTTGTACTGTATAGGCATAAGCTCGAGCTTATGCCTATACAGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-4470s21c1
Sequence:CCGGTTCGGAGGAGAAGGGTCATAACTCGAGTTATGACCCTTCTCCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-2558s21c1
Sequence:CCGGTCGTGCTTTGGCCAGATTAAACTCGAGTTTAATCTGGCCAAAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040400.2-6858s21c1
Sequence:CCGGATGTCCTTGTAGGACTATAATCTCGAGATTATAGTCCTACAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040400
TET2 MISSION shRNA Lentiviral Transduction Particles
tet methylcytosine dioxygenase 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-2290s21c1
Sequence:CCGGGAGCGTTCCTCAGTATCATTTCTCGAGAAATGATACTGAGGAACGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-2819s21c1
Sequence:CCGGATGCAGTATTTCCCGAATAATCTCGAGATTATTCGGGAAATACTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001040400.2-5819s1c1
Sequence:CCGGCTTGTACTGTATAGGCATAAGCTCGAGCTTATGCCTATACAGTACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-4470s21c1
Sequence:CCGGTTCGGAGGAGAAGGGTCATAACTCGAGTTATGACCCTTCTCCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040400.2-2558s21c1
Sequence:CCGGTCGTGCTTTGGCCAGATTAAACTCGAGTTTAATCTGGCCAAAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001040400.2-6858s21c1
Sequence:CCGGATGTCCTTGTAGGACTATAATCTCGAGATTATAGTCCTACAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks