EMAIL THIS PAGE TO A FRIEND

TET3

tet methylcytosine dioxygenase 3

UniProtKB ID: O43151, A6NEI3, Q86Z24, Q8TBM9
Gene ID:
Human(200424) Summary: Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]
Mouse(194388) tet methylcytosine dioxygenase 3
Rat(680576) tet methylcytosine dioxygenase 3
cow(538707) tet methylcytosine dioxygenase 3
sheep(101105649) tet methylcytosine dioxygenase 3
domestic guinea pig(100715975) tet methylcytosine dioxygenase 3
Domestic Rabbit(100350148) tet methylcytosine dioxygenase 3
naked mole-rat(101710771) tet methylcytosine dioxygenase 3
Thale Cress(823702) tetraspanin3
chicken(425829) tet oncogene family member 3
Horse(100057820) tet methylcytosine dioxygenase 3
domestic cat(101083580) tet methylcytosine dioxygenase 3
dog(483109) tet methylcytosine dioxygenase 3
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144993 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144993 Rosetta Predictions human pricing
XM_371501 Rosetta Predictions human pricing
XM_001057850 Rosetta Predictions rat pricing
XM_886913 Rosetta Predictions mouse pricing
XM_914443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364816 predicted 3995
2 SASI_Hs02_00364817 predicted 426
3 SASI_Hs02_00364818 predicted 1004
4 SASI_Hs02_00364819 predicted 2090
5 SASI_Hs02_00364820 predicted 1722
6 SASI_Hs02_00364821 predicted 2568
7 SASI_Hs02_00364822 predicted 2152
8 SASI_Hs02_00364823 predicted 3343
9 SASI_Hs02_00364824 predicted 664
10 SASI_Hs02_00364825 predicted 2880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253724 predicted 4221
2 SASI_Hs01_00253725 predicted 3454
3 SASI_Hs01_00253726 predicted 2570
4 SASI_Hs01_00253727 predicted 3458
5 SASI_Hs01_00253728 predicted 4071
6 SASI_Hs01_00253729 predicted 4450
7 SASI_Hs01_00253730 predicted 2790
8 SASI_Hs01_00253731 predicted 5152
9 SASI_Hs01_00253732 predicted 2757
10 SASI_Hs01_00253733 predicted 3132
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287726 predicted 1000
2 SASI_Rn02_00287727 predicted 1355
3 SASI_Rn02_00287728 predicted 1422
4 SASI_Rn02_00287729 predicted 2917
5 SASI_Rn02_00287730 predicted 1933
6 SASI_Rn02_00287731 predicted 1755
7 SASI_Rn02_00287732 predicted 1982
8 SASI_Rn02_00287733 predicted 720
9 SASI_Rn02_00287734 predicted 2311
10 SASI_Rn02_00287735 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00244277 predicted 2625
2 SASI_Mm01_00244279 predicted 1643
3 SASI_Mm01_00244280 predicted 5137
4 SASI_Mm01_00244281 predicted 1173
5 SASI_Mm01_00244282 predicted 2542
6 SASI_Mm01_00244283 predicted 2242
7 SASI_Mm01_00244284 predicted 2304
8 SASI_Mm01_00244285 predicted 4519
9 SASI_Mm02_00428425 predicted 2220
10 SASI_Mm02_00428426 predicted 3962
11 SASI_Mm01_00244278 predicted 4372
12 SASI_Mm01_00244286 predicted 3962
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438538 predicted 2629
2 SASI_Mm02_00438539 predicted 1649
3 SASI_Mm02_00438540 predicted 5137
4 SASI_Mm02_00438541 predicted 1172
5 SASI_Mm02_00438542 predicted 2537
6 SASI_Mm02_00438543 predicted 2250
7 SASI_Mm02_00438544 predicted 2308
8 SASI_Mm02_00438545 predicted 4521
9 SASI_Mm02_00438546 predicted 2224
10 SASI_Mm02_00438547 predicted 3966
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183138
TET3 MISSION shRNA Bacterial Glycerol Stock
tet methylcytosine dioxygenase 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-1828s21c1
Sequence:CCGGGAACCTTCTCTTGCGCTATTTCTCGAGAAATAGCGCAAGAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2241s21c1
Sequence:CCGGCTTCTTGGAGTCACCTCTAAACTCGAGTTTAGAGGTGACTCCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2358s21c1
Sequence:CCGGGAAAGATGAAGGCCCATATTACTCGAGTAATATGGGCCTTCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-3075s21c1
Sequence:CCGGCGCCCACAAGGACCAACATAACTCGAGTTATGTTGGTCCTTGTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2263s21c1
Sequence:CCGGTACCTAGACACACCTACTAAGCTCGAGCTTAGTAGGTGTGTCTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-4610s21c1
Sequence:CCGGGCTCCAACGAGAAGCTATTTGCTCGAGCAAATAGCTTCTCGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2681s21c1
Sequence:CCGGCTGATACCCTCCGGAAGTATGCTCGAGCATACTTCCGGAGGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183138
TET3 MISSION shRNA shRNA Plasmid DNA
tet methylcytosine dioxygenase 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-1828s21c1
Sequence:CCGGGAACCTTCTCTTGCGCTATTTCTCGAGAAATAGCGCAAGAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2241s21c1
Sequence:CCGGCTTCTTGGAGTCACCTCTAAACTCGAGTTTAGAGGTGACTCCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2358s21c1
Sequence:CCGGGAAAGATGAAGGCCCATATTACTCGAGTAATATGGGCCTTCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-3075s21c1
Sequence:CCGGCGCCCACAAGGACCAACATAACTCGAGTTATGTTGGTCCTTGTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2263s21c1
Sequence:CCGGTACCTAGACACACCTACTAAGCTCGAGCTTAGTAGGTGTGTCTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-4610s21c1
Sequence:CCGGGCTCCAACGAGAAGCTATTTGCTCGAGCAAATAGCTTCTCGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2681s21c1
Sequence:CCGGCTGATACCCTCCGGAAGTATGCTCGAGCATACTTCCGGAGGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183138
TET3 MISSION shRNA Lentiviral Transduction Particles
tet methylcytosine dioxygenase 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-1828s21c1
Sequence:CCGGGAACCTTCTCTTGCGCTATTTCTCGAGAAATAGCGCAAGAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2241s21c1
Sequence:CCGGCTTCTTGGAGTCACCTCTAAACTCGAGTTTAGAGGTGACTCCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2358s21c1
Sequence:CCGGGAAAGATGAAGGCCCATATTACTCGAGTAATATGGGCCTTCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-3075s21c1
Sequence:CCGGCGCCCACAAGGACCAACATAACTCGAGTTATGTTGGTCCTTGTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2263s21c1
Sequence:CCGGTACCTAGACACACCTACTAAGCTCGAGCTTAGTAGGTGTGTCTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-4610s21c1
Sequence:CCGGGCTCCAACGAGAAGCTATTTGCTCGAGCAAATAGCTTCTCGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183138.2-2681s21c1
Sequence:CCGGCTGATACCCTCCGGAAGTATGCTCGAGCATACTTCCGGAGGGTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144993
TET3 MISSION shRNA Bacterial Glycerol Stock
tet methylcytosine dioxygenase 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-1576s21c1
Sequence:CCGGGAACCTTCTCTTGCGCTATTTCTCGAGAAATAGCGCAAGAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-214s21c1
Sequence:CCGGGCCGAAGCTGTGTCCTCTTATCTCGAGATAAGAGGACACAGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-3368s21c1
Sequence:CCGGACTCCTACCACTCCTACTATGCTCGAGCATAGTAGGAGTGGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144993.1-10421s21c1
Sequence:CCGGGGTCGTATAATGGCATATTAACTCGAGTTAATATGCCATTATACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-2103s21c1
Sequence:CCGGGAAAGATGAAGGTCCATATTACTCGAGTAATATGGACCTTCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144993
TET3 MISSION shRNA shRNA Plasmid DNA
tet methylcytosine dioxygenase 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-1576s21c1
Sequence:CCGGGAACCTTCTCTTGCGCTATTTCTCGAGAAATAGCGCAAGAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-214s21c1
Sequence:CCGGGCCGAAGCTGTGTCCTCTTATCTCGAGATAAGAGGACACAGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-3368s21c1
Sequence:CCGGACTCCTACCACTCCTACTATGCTCGAGCATAGTAGGAGTGGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144993.1-10421s21c1
Sequence:CCGGGGTCGTATAATGGCATATTAACTCGAGTTAATATGCCATTATACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-2103s21c1
Sequence:CCGGGAAAGATGAAGGTCCATATTACTCGAGTAATATGGACCTTCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144993
TET3 MISSION shRNA Lentiviral Transduction Particles
tet methylcytosine dioxygenase 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-1576s21c1
Sequence:CCGGGAACCTTCTCTTGCGCTATTTCTCGAGAAATAGCGCAAGAGAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-214s21c1
Sequence:CCGGGCCGAAGCTGTGTCCTCTTATCTCGAGATAAGAGGACACAGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-3368s21c1
Sequence:CCGGACTCCTACCACTCCTACTATGCTCGAGCATAGTAGGAGTGGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144993.1-10421s21c1
Sequence:CCGGGGTCGTATAATGGCATATTAACTCGAGTTAATATGCCATTATACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144993.1-2103s21c1
Sequence:CCGGGAAAGATGAAGGTCCATATTACTCGAGTAATATGGACCTTCATCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks