EMAIL THIS PAGE TO A FRIEND

TEX101

testis expressed 101

Synonyms: CT131 GTPR867 NYD-SP8 PRO1884 SGRG SPATA44 TES101RP
UniProtKB ID: Q9BY14, Q7L5R2, Q9BPY7
Gene ID:
Mouse(56746) testis expressed gene 101
Rat(207113) testis expressed 101
dog(612423) testis expressed 101
domestic cat(101081590) testis expressed 101
domestic guinea pig(100714089) testis expressed 101
naked mole-rat(101697632) testis expressed 101
cow(616282) testis expressed 101
sheep(101107380) testis expressed 101
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031451 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031451 Rosetta Predictions human pricing
NM_139037 Rosetta Predictions rat pricing
NM_019981 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049804 predicted 1318
2 SASI_Hs01_00049805 predicted 1281
3 SASI_Hs01_00049807 predicted 1207
4 SASI_Hs01_00049808 predicted 1339
5 SASI_Hs01_00049809 predicted 1250
6 SASI_Hs01_00049810 predicted 1321
7 SASI_Hs01_00049811 predicted 783
8 SASI_Hs01_00049812 predicted 981
9 SASI_Hs01_00049813 predicted 995
10 SASI_Hs02_00358863 predicted 1006
11 SASI_Hs01_00049806 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110204 predicted 614
2 SASI_Rn02_00268415 predicted 317
3 SASI_Rn01_00110205 predicted 471
4 SASI_Rn01_00110206 predicted 523
5 SASI_Rn01_00110207 predicted 556
6 SASI_Rn01_00110209 predicted 248
7 SASI_Rn01_00110210 predicted 341
8 SASI_Rn01_00110211 predicted 519
9 SASI_Rn01_00110212 predicted 333
10 SASI_Rn01_00110213 predicted 457
11 SASI_Rn01_00110208 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325304 predicted 715
2 SASI_Mm02_00325305 predicted 711
3 SASI_Mm02_00325306 predicted 456
4 SASI_Mm02_00325307 predicted 631
5 SASI_Mm02_00325308 predicted 429
6 SASI_Mm02_00325309 predicted 805
7 SASI_Mm02_00325310 predicted 728
8 SASI_Mm02_00325311 predicted 308
9 SASI_Mm02_00325312 predicted 726
10 SASI_Mm02_00325313 predicted 664
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031451
TEX101 MISSION shRNA Bacterial Glycerol Stock
testis expressed 101
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-1337s1c1
Sequence:CCGGGCTGCCATCATTTATTCACTTCTCGAGAAGTGAATAAATGATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-793s1c1
Sequence:CCGGGCCAGGAAACCATACTAATAACTCGAGTTATTAGTATGGTTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-917s1c1
Sequence:CCGGCGTGACCTCCTACAGTAACTACTCGAGTAGTTACTGTAGGAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-1012s1c1
Sequence:CCGGCTGTGTCAACAACCCTCCATTCTCGAGAATGGAGGGTTGTTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-1088s1c1
Sequence:CCGGCAATGGTACAACTCGATGCTACTCGAGTAGCATCGAGTTGTACCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031451.4-1145s21c1
Sequence:CCGGAGTCGTCTGTGGAGGTCAAAGCTCGAGCTTTGACCTCCACAGACGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031451.4-1190s21c1
Sequence:CCGGGGCTGATGTCTGGAATCTTAGCTCGAGCTAAGATTCCAGACATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031451
TEX101 MISSION shRNA shRNA Plasmid DNA
testis expressed 101
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-1337s1c1
Sequence:CCGGGCTGCCATCATTTATTCACTTCTCGAGAAGTGAATAAATGATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-793s1c1
Sequence:CCGGGCCAGGAAACCATACTAATAACTCGAGTTATTAGTATGGTTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-917s1c1
Sequence:CCGGCGTGACCTCCTACAGTAACTACTCGAGTAGTTACTGTAGGAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-1012s1c1
Sequence:CCGGCTGTGTCAACAACCCTCCATTCTCGAGAATGGAGGGTTGTTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-1088s1c1
Sequence:CCGGCAATGGTACAACTCGATGCTACTCGAGTAGCATCGAGTTGTACCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031451.4-1145s21c1
Sequence:CCGGAGTCGTCTGTGGAGGTCAAAGCTCGAGCTTTGACCTCCACAGACGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031451.4-1190s21c1
Sequence:CCGGGGCTGATGTCTGGAATCTTAGCTCGAGCTAAGATTCCAGACATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031451
TEX101 MISSION shRNA Lentiviral Transduction Particles
testis expressed 101
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-1337s1c1
Sequence:CCGGGCTGCCATCATTTATTCACTTCTCGAGAAGTGAATAAATGATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-793s1c1
Sequence:CCGGGCCAGGAAACCATACTAATAACTCGAGTTATTAGTATGGTTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-917s1c1
Sequence:CCGGCGTGACCTCCTACAGTAACTACTCGAGTAGTTACTGTAGGAGGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-1012s1c1
Sequence:CCGGCTGTGTCAACAACCCTCCATTCTCGAGAATGGAGGGTTGTTGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031451.3-1088s1c1
Sequence:CCGGCAATGGTACAACTCGATGCTACTCGAGTAGCATCGAGTTGTACCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031451.4-1145s21c1
Sequence:CCGGAGTCGTCTGTGGAGGTCAAAGCTCGAGCTTTGACCTCCACAGACGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031451.4-1190s21c1
Sequence:CCGGGGCTGATGTCTGGAATCTTAGCTCGAGCTAAGATTCCAGACATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019981
VALIDATED
TEX101 MISSION shRNA Bacterial Glycerol Stock
testis expressed 101
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019981.1-920s1c1
Sequence:CCGGTGGTCCTAGACACTGGACTTTCTCGAGAAAGTCCAGTGTCTAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-400s1c1
Sequence:CCGGGCGGTGACTTTCATCCAGTATCTCGAGATACTGGATGAAAGTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-628s1c1
Sequence:CCGGCAGTGCTATCAAGGAAGACTTCTCGAGAAGTCTTCCTTGATAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-260s1c1
Sequence:CCGGGCCGTACCTTTAACTGGACTTCTCGAGAAGTCCAGTTAAAGGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-762s1c1
Sequence:CCGGGACCTGTAGTTACCAGTCATTCTCGAGAATGACTGGTAACTACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-672s21c1
Sequence:CCGGGACGCCACCGTGCAAGTTAAACTCGAGTTTAACTTGCACGGTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-218s21c1
Sequence:CCGGCTACTGCCAGGTGAGTCAAACCTCGAGGTTTGACTCACCTGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-253s21c1
Sequence:CCGGACGATCCAGGCCGTACCTTTACTCGAGTAAAGGTACGGCCTGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019981.2-404s21c1
Sequence:CCGGGGTGACTTTCATCCAGTATACCTCGAGGTATACTGGATGAAAGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-321s21c1
Sequence:CCGGGAAACGGTCCTGTTGATTAAACTCGAGTTTAATCAACAGGACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019981
VALIDATED
TEX101 MISSION shRNA shRNA Plasmid DNA
testis expressed 101
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019981.1-920s1c1
Sequence:CCGGTGGTCCTAGACACTGGACTTTCTCGAGAAAGTCCAGTGTCTAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-400s1c1
Sequence:CCGGGCGGTGACTTTCATCCAGTATCTCGAGATACTGGATGAAAGTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-628s1c1
Sequence:CCGGCAGTGCTATCAAGGAAGACTTCTCGAGAAGTCTTCCTTGATAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-260s1c1
Sequence:CCGGGCCGTACCTTTAACTGGACTTCTCGAGAAGTCCAGTTAAAGGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-762s1c1
Sequence:CCGGGACCTGTAGTTACCAGTCATTCTCGAGAATGACTGGTAACTACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-672s21c1
Sequence:CCGGGACGCCACCGTGCAAGTTAAACTCGAGTTTAACTTGCACGGTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-218s21c1
Sequence:CCGGCTACTGCCAGGTGAGTCAAACCTCGAGGTTTGACTCACCTGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-253s21c1
Sequence:CCGGACGATCCAGGCCGTACCTTTACTCGAGTAAAGGTACGGCCTGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019981.2-404s21c1
Sequence:CCGGGGTGACTTTCATCCAGTATACCTCGAGGTATACTGGATGAAAGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-321s21c1
Sequence:CCGGGAAACGGTCCTGTTGATTAAACTCGAGTTTAATCAACAGGACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019981
VALIDATED
TEX101 MISSION shRNA Lentiviral Transduction Particles
testis expressed 101
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019981.1-920s1c1
Sequence:CCGGTGGTCCTAGACACTGGACTTTCTCGAGAAAGTCCAGTGTCTAGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-400s1c1
Sequence:CCGGGCGGTGACTTTCATCCAGTATCTCGAGATACTGGATGAAAGTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-628s1c1
Sequence:CCGGCAGTGCTATCAAGGAAGACTTCTCGAGAAGTCTTCCTTGATAGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-260s1c1
Sequence:CCGGGCCGTACCTTTAACTGGACTTCTCGAGAAGTCCAGTTAAAGGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019981.1-762s1c1
Sequence:CCGGGACCTGTAGTTACCAGTCATTCTCGAGAATGACTGGTAACTACAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-672s21c1
Sequence:CCGGGACGCCACCGTGCAAGTTAAACTCGAGTTTAACTTGCACGGTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-218s21c1
Sequence:CCGGCTACTGCCAGGTGAGTCAAACCTCGAGGTTTGACTCACCTGGCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-253s21c1
Sequence:CCGGACGATCCAGGCCGTACCTTTACTCGAGTAAAGGTACGGCCTGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019981.2-404s21c1
Sequence:CCGGGGTGACTTTCATCCAGTATACCTCGAGGTATACTGGATGAAAGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019981.2-321s21c1
Sequence:CCGGGAAACGGTCCTGTTGATTAAACTCGAGTTTAATCAACAGGACCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks