EMAIL THIS PAGE TO A FRIEND

TEX10

testis expressed 10

Synonyms: Ipi1 bA208F1.2
UniProtKB ID: Q9NXF1, B4DYV2, Q5T722, Q5T723, Q8NCN8, Q8TDY0
Gene ID:
Mouse(269536) testis expressed gene 10
Rat(298065) testis expressed 10
cow(522819) testis expressed 10
sheep(101121747) testis expressed 10
naked mole-rat(101714359) testis expressed 10
Domestic Rabbit(100349882) testis expressed 10
domestic guinea pig(100718403) testis expressed 10
Zebrafish(327196) testis expressed 10
Horse(100063401) testis expressed 10
domestic cat(101085325) testis expressed 10
dog(474782) testis expressed 10
chicken(420993) testis expressed 10
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017746 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017746 Rosetta Predictions human pricing
NM_001106653 Rosetta Predictions rat pricing
NM_172304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146456 predicted 2395
2 SASI_Hs01_00146457 predicted 2012
3 SASI_Hs01_00146458 predicted 1670
4 SASI_Hs01_00146459 predicted 1749
5 SASI_Hs01_00146460 predicted 2520
6 SASI_Hs01_00146461 predicted 638
7 SASI_Hs01_00146462 predicted 1730
8 SASI_Hs01_00146463 predicted 1905
9 SASI_Hs01_00146464 predicted 2281
10 SASI_Hs02_00350554 predicted 613
11 SASI_Hs01_00146465 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221068 predicted 734
2 SASI_Rn02_00221069 predicted 1066
3 SASI_Rn02_00221070 predicted 2546
4 SASI_Rn02_00221071 predicted 1431
5 SASI_Rn02_00221072 predicted 2566
6 SASI_Rn02_00221073 predicted 1793
7 SASI_Rn02_00221074 predicted 2809
8 SASI_Rn02_00221075 predicted 2024
9 SASI_Rn02_00221076 predicted 2727
10 SASI_Rn02_00221077 predicted 1195
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343798 predicted 1952
2 SASI_Mm02_00343799 predicted 597
3 SASI_Mm02_00343800 predicted 914
4 SASI_Mm02_00343801 predicted 2859
5 SASI_Mm02_00343802 predicted 2399
6 SASI_Mm02_00343803 predicted 1661
7 SASI_Mm02_00343804 predicted 1886
8 SASI_Mm02_00343805 predicted 1710
9 SASI_Mm02_00343806 predicted 1943
10 SASI_Mm02_00343807 predicted 1006
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017746
VALIDATED
TEX10 MISSION shRNA Bacterial Glycerol Stock
testis expressed 10
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-2063s21c1
Sequence:CCGGGCGTTTGGTTCAGCTTGTATACTCGAGTATACAAGCTGAACCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017746.3-1994s21c1
Sequence:CCGGAGCTACTGCCCTCCGAATTTACTCGAGTAAATTCGGAGGGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-1665s21c1
Sequence:CCGGGGAGTATCCTGGAGGTTAATGCTCGAGCATTAACCTCCAGGATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-2238s21c1
Sequence:CCGGATGAGTGATGTAGACTATTTCCTCGAGGAAATAGTCTACATCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-1833s21c1
Sequence:CCGGAGATTCAGATATCGTAGTAAACTCGAGTTTACTACGATATCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017746.3-2938s21c1
Sequence:CCGGATTACTGCTTCAACGTGTATACTCGAGTATACACGTTGAAGCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017746.3-2184s21c1
Sequence:CCGGCTGCACATGAGATCATCATTTCTCGAGAAATGATGATCTCATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017746.1-2019s1c1
Sequence:CCGGGCTGATTTGCTTTCTCGGTTACTCGAGTAACCGAGAAAGCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-520s1c1
Sequence:CCGGGAGCTGAACAAATTTCTCCATCTCGAGATGGAGAAATTTGTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-1761s1c1
Sequence:CCGGCGTAGTAAAGTGTTATCCCGTCTCGAGACGGGATAACACTTTACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-2845s1c1
Sequence:CCGGCAGACTTACATTACTGCTTTACTCGAGTAAAGCAGTAATGTAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-1550s1c1
Sequence:CCGGGCTAAATAGTAAGCAACTGAACTCGAGTTCAGTTGCTTACTATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-2792s1c1
Sequence:CCGGCATCAAGAATATCACGACATTCTCGAGAATGTCGTGATATTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-1492s1c1
Sequence:CCGGGCAGTTGGATAGAAATGATAACTCGAGTTATCATTTCTATCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-2288s1c1
Sequence:CCGGCCTTACAGATTTGGATCAATTCTCGAGAATTGATCCAAATCTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-1875s1c1
Sequence:CCGGGCACGAGCAAATAAAGAATTACTCGAGTAATTCTTTATTTGCTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017746
VALIDATED
TEX10 MISSION shRNA shRNA Plasmid DNA
testis expressed 10
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-2063s21c1
Sequence:CCGGGCGTTTGGTTCAGCTTGTATACTCGAGTATACAAGCTGAACCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017746.3-1994s21c1
Sequence:CCGGAGCTACTGCCCTCCGAATTTACTCGAGTAAATTCGGAGGGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-1665s21c1
Sequence:CCGGGGAGTATCCTGGAGGTTAATGCTCGAGCATTAACCTCCAGGATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-2238s21c1
Sequence:CCGGATGAGTGATGTAGACTATTTCCTCGAGGAAATAGTCTACATCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-1833s21c1
Sequence:CCGGAGATTCAGATATCGTAGTAAACTCGAGTTTACTACGATATCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017746.3-2938s21c1
Sequence:CCGGATTACTGCTTCAACGTGTATACTCGAGTATACACGTTGAAGCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017746.3-2184s21c1
Sequence:CCGGCTGCACATGAGATCATCATTTCTCGAGAAATGATGATCTCATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017746.1-2019s1c1
Sequence:CCGGGCTGATTTGCTTTCTCGGTTACTCGAGTAACCGAGAAAGCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-520s1c1
Sequence:CCGGGAGCTGAACAAATTTCTCCATCTCGAGATGGAGAAATTTGTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-1761s1c1
Sequence:CCGGCGTAGTAAAGTGTTATCCCGTCTCGAGACGGGATAACACTTTACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-2845s1c1
Sequence:CCGGCAGACTTACATTACTGCTTTACTCGAGTAAAGCAGTAATGTAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-1550s1c1
Sequence:CCGGGCTAAATAGTAAGCAACTGAACTCGAGTTCAGTTGCTTACTATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-2792s1c1
Sequence:CCGGCATCAAGAATATCACGACATTCTCGAGAATGTCGTGATATTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-1492s1c1
Sequence:CCGGGCAGTTGGATAGAAATGATAACTCGAGTTATCATTTCTATCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-2288s1c1
Sequence:CCGGCCTTACAGATTTGGATCAATTCTCGAGAATTGATCCAAATCTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-1875s1c1
Sequence:CCGGGCACGAGCAAATAAAGAATTACTCGAGTAATTCTTTATTTGCTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017746
VALIDATED
TEX10 MISSION shRNA Lentiviral Transduction Particles
testis expressed 10
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-2063s21c1
Sequence:CCGGGCGTTTGGTTCAGCTTGTATACTCGAGTATACAAGCTGAACCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017746.3-1994s21c1
Sequence:CCGGAGCTACTGCCCTCCGAATTTACTCGAGTAAATTCGGAGGGCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-1665s21c1
Sequence:CCGGGGAGTATCCTGGAGGTTAATGCTCGAGCATTAACCTCCAGGATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-2238s21c1
Sequence:CCGGATGAGTGATGTAGACTATTTCCTCGAGGAAATAGTCTACATCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017746.3-1833s21c1
Sequence:CCGGAGATTCAGATATCGTAGTAAACTCGAGTTTACTACGATATCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017746.3-2938s21c1
Sequence:CCGGATTACTGCTTCAACGTGTATACTCGAGTATACACGTTGAAGCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017746.3-2184s21c1
Sequence:CCGGCTGCACATGAGATCATCATTTCTCGAGAAATGATGATCTCATGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017746.1-2019s1c1
Sequence:CCGGGCTGATTTGCTTTCTCGGTTACTCGAGTAACCGAGAAAGCAAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134284    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-520s1c1
Sequence:CCGGGAGCTGAACAAATTTCTCCATCTCGAGATGGAGAAATTTGTTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-1761s1c1
Sequence:CCGGCGTAGTAAAGTGTTATCCCGTCTCGAGACGGGATAACACTTTACTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160598    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-2845s1c1
Sequence:CCGGCAGACTTACATTACTGCTTTACTCGAGTAAAGCAGTAATGTAAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017746.1-1550s1c1
Sequence:CCGGGCTAAATAGTAAGCAACTGAACTCGAGTTCAGTTGCTTACTATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-2792s1c1
Sequence:CCGGCATCAAGAATATCACGACATTCTCGAGAATGTCGTGATATTCTTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-1492s1c1
Sequence:CCGGGCAGTTGGATAGAAATGATAACTCGAGTTATCATTTCTATCCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-2288s1c1
Sequence:CCGGCCTTACAGATTTGGATCAATTCTCGAGAATTGATCCAAATCTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017746.1-1875s1c1
Sequence:CCGGGCACGAGCAAATAAAGAATTACTCGAGTAATTCTTTATTTGCTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172304
VALIDATED
TEX10 MISSION shRNA Bacterial Glycerol Stock
testis expressed 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-2392s21c1
Sequence:CCGGGGATGGAGTCACTCGGTTAATCTCGAGATTAACCGAGTGACTCCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-2179s21c1
Sequence:CCGGGCTGCCGCTCTACGAATTTATCTCGAGATAAATTCGTAGAGCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-2341s21c1
Sequence:CCGGAGTTTGGCTGTCACGCTTATTCTCGAGAATAAGCGTGACAGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-541s21c1
Sequence:CCGGGATAGAACACTTCCGACAAACCTCGAGGTTTGTCGGAAGTGTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172304.3-3020s21c1
Sequence:CCGGGGTCGCACATGCTGACTAATGCTCGAGCATTAGTCAGCATGTGCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172304
VALIDATED
TEX10 MISSION shRNA shRNA Plasmid DNA
testis expressed 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-2392s21c1
Sequence:CCGGGGATGGAGTCACTCGGTTAATCTCGAGATTAACCGAGTGACTCCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-2179s21c1
Sequence:CCGGGCTGCCGCTCTACGAATTTATCTCGAGATAAATTCGTAGAGCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-2341s21c1
Sequence:CCGGAGTTTGGCTGTCACGCTTATTCTCGAGAATAAGCGTGACAGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-541s21c1
Sequence:CCGGGATAGAACACTTCCGACAAACCTCGAGGTTTGTCGGAAGTGTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172304.3-3020s21c1
Sequence:CCGGGGTCGCACATGCTGACTAATGCTCGAGCATTAGTCAGCATGTGCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172304
VALIDATED
TEX10 MISSION shRNA Lentiviral Transduction Particles
testis expressed 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-2392s21c1
Sequence:CCGGGGATGGAGTCACTCGGTTAATCTCGAGATTAACCGAGTGACTCCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-2179s21c1
Sequence:CCGGGCTGCCGCTCTACGAATTTATCTCGAGATAAATTCGTAGAGCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-2341s21c1
Sequence:CCGGAGTTTGGCTGTCACGCTTATTCTCGAGAATAAGCGTGACAGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172304.3-541s21c1
Sequence:CCGGGATAGAACACTTCCGACAAACCTCGAGGTTTGTCGGAAGTGTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172304.3-3020s21c1
Sequence:CCGGGGTCGCACATGCTGACTAATGCTCGAGCATTAGTCAGCATGTGCGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks