EMAIL THIS PAGE TO A FRIEND

TEX11

testis expressed 11

Synonyms: TGC1 TSGA3
UniProtKB ID: Q8IYF3, A8K8V6, Q5JQQ8, Q96LZ4, Q96M47, Q9BXU6
Gene ID:
Human(56159) Summary: This gene is X-linked and is expressed in only male germ cells. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(83558) testis expressed gene 11
Rat(501588) testis expressed 11
cow(515297) testis expressed 11
sheep(101121752) testis expressed 11
chicken(422215) testis expressed 11
Horse(100056710) testis expressed 11
domestic cat(101101291) testis expressed 11
dog(607665) testis expressed 11
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031276 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031384 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031384 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031384 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019191 MISSION® esiRNA esiRNA targeting human TEX11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003811 Rosetta Predictions human pricing
NM_031276 Rosetta Predictions human pricing
XM_001069708 Rosetta Predictions rat pricing
XM_576992 Rosetta Predictions rat pricing
NM_031384 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304402 predicted 972
2 SASI_Hs01_00195713 predicted 1685
3 SASI_Hs01_00195714 predicted 754
4 SASI_Hs01_00195715 predicted 2777
5 SASI_Hs01_00195717 predicted 2024
6 SASI_Hs01_00195718 predicted 616
7 SASI_Hs01_00195719 predicted 2306
8 SASI_Hs01_00195720 predicted 2147
9 SASI_Hs01_00195721 predicted 832
10 SASI_Hs01_00195722 predicted 2402
11 SASI_Hs01_00195716 predicted 2924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358692 predicted 849
2 SASI_Hs01_00042712 predicted 1559
3 SASI_Hs01_00042713 predicted 638
4 SASI_Hs01_00042714 predicted 2662
5 SASI_Hs01_00042716 predicted 1903
6 SASI_Hs01_00042717 predicted 488
7 SASI_Hs01_00042718 predicted 2192
8 SASI_Hs01_00042719 predicted 2018
9 SASI_Hs01_00042720 predicted 712
10 SASI_Hs01_00042721 predicted 2276
11 SASI_Hs01_00042715 predicted 2801
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328981 predicted 208
2 SASI_Rn02_00328982 predicted 2292
3 SASI_Rn02_00328983 predicted 1051
4 SASI_Rn02_00328984 predicted 512
5 SASI_Rn02_00328985 predicted 1116
6 SASI_Rn02_00328986 predicted 1094
7 SASI_Rn02_00328987 predicted 453
8 SASI_Rn02_00328988 predicted 387
9 SASI_Rn02_00328989 predicted 592
10 SASI_Rn02_00328990 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00406044 predicted 2302
2 SASI_Rn02_00406045 predicted 344
3 SASI_Rn02_00406046 predicted 2482
4 SASI_Rn02_00406047 predicted 704
5 SASI_Rn02_00406048 predicted 198
6 SASI_Rn02_00406049 predicted 397
7 SASI_Rn02_00406050 predicted 647
8 SASI_Rn02_00406051 predicted 569
9 SASI_Rn02_00406052 predicted 777
10 SASI_Rn02_00406053 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031384 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179451 predicted 1694
2 SASI_Mm01_00179452 predicted 2681
3 SASI_Mm01_00179453 predicted 1919
4 SASI_Mm01_00179454 predicted 563
5 SASI_Mm01_00179455 predicted 199
6 SASI_Mm01_00179456 predicted 1030
7 SASI_Mm01_00179457 predicted 399
8 SASI_Mm01_00179458 predicted 1532
9 SASI_Mm01_00179460 predicted 2734
10 SASI_Mm02_00337130 predicted 1302
11 SASI_Mm01_00179459 predicted 2721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031276
TEX11 MISSION shRNA Bacterial Glycerol Stock
testis expressed 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031276.2-147s21c1
Sequence:CCGGATGATAATTCACCTAACATACCTCGAGGTATGTTAGGTGAATTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031276.2-772s21c1
Sequence:CCGGGCTTAGCCAAAGCTATGATATCTCGAGATATCATAGCTTTGGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-2506s1c1
Sequence:CCGGGCACTAAAGACTACCCAGAAACTCGAGTTTCTGGGTAGTCTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-944s1c1
Sequence:CCGGGCCCTTAGACTTCTGTCTGAACTCGAGTTCAGACAGAAGTCTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-543s1c1
Sequence:CCGGGCATCTATGTGTGTACTGCAACTCGAGTTGCAGTACACACATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-1772s1c1
Sequence:CCGGCCTGAATAGAGCCTTTGTGAACTCGAGTTCACAAAGGCTCTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-2387s1c1
Sequence:CCGGCAGCAAATGTATGCACAACTTCTCGAGAAGTTGTGCATACATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031276
TEX11 MISSION shRNA shRNA Plasmid DNA
testis expressed 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031276.2-147s21c1
Sequence:CCGGATGATAATTCACCTAACATACCTCGAGGTATGTTAGGTGAATTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031276.2-772s21c1
Sequence:CCGGGCTTAGCCAAAGCTATGATATCTCGAGATATCATAGCTTTGGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-2506s1c1
Sequence:CCGGGCACTAAAGACTACCCAGAAACTCGAGTTTCTGGGTAGTCTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-944s1c1
Sequence:CCGGGCCCTTAGACTTCTGTCTGAACTCGAGTTCAGACAGAAGTCTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-543s1c1
Sequence:CCGGGCATCTATGTGTGTACTGCAACTCGAGTTGCAGTACACACATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-1772s1c1
Sequence:CCGGCCTGAATAGAGCCTTTGTGAACTCGAGTTCACAAAGGCTCTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-2387s1c1
Sequence:CCGGCAGCAAATGTATGCACAACTTCTCGAGAAGTTGTGCATACATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031276
TEX11 MISSION shRNA Lentiviral Transduction Particles
testis expressed 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031276.2-147s21c1
Sequence:CCGGATGATAATTCACCTAACATACCTCGAGGTATGTTAGGTGAATTATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031276.2-772s21c1
Sequence:CCGGGCTTAGCCAAAGCTATGATATCTCGAGATATCATAGCTTTGGCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-2506s1c1
Sequence:CCGGGCACTAAAGACTACCCAGAAACTCGAGTTTCTGGGTAGTCTTTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-944s1c1
Sequence:CCGGGCCCTTAGACTTCTGTCTGAACTCGAGTTCAGACAGAAGTCTAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-543s1c1
Sequence:CCGGGCATCTATGTGTGTACTGCAACTCGAGTTGCAGTACACACATAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-1772s1c1
Sequence:CCGGCCTGAATAGAGCCTTTGTGAACTCGAGTTCACAAAGGCTCTATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031276.1-2387s1c1
Sequence:CCGGCAGCAAATGTATGCACAACTTCTCGAGAAGTTGTGCATACATTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031384
TEX11 MISSION shRNA Bacterial Glycerol Stock
testis expressed 11
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031384.1-796s1c1
Sequence:CCGGGAAGCAAGCAAGCGGAATAAACTCGAGTTTATTCCGCTTGCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031384.1-2458s1c1
Sequence:CCGGCCTGCATACTATCCTACTATTCTCGAGAATAGTAGGATAGTATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-1540s1c1
Sequence:CCGGGCCATAGCAGAAGTTGAGCAACTCGAGTTGCTCAACTTCTGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031384.1-1075s1c1
Sequence:CCGGGCTGCTAAGGAAATACTATATCTCGAGATATAGTATTTCCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-1379s1c1
Sequence:CCGGCCAGAAGTGTTAAGGTCCAAACTCGAGTTTGGACCTTAACACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-2584s1c1
Sequence:CCGGGCAGATGAAGTATGGAATATACTCGAGTATATTCCATACTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031384.1-3071s1c1
Sequence:CCGGCAGTGGAGAGTCATAATGATTCTCGAGAATCATTATGACTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-385s1c1
Sequence:CCGGGCAGCTAAACTGTGTTATATTCTCGAGAATATAACACAGTTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031384
TEX11 MISSION shRNA shRNA Plasmid DNA
testis expressed 11
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031384.1-796s1c1
Sequence:CCGGGAAGCAAGCAAGCGGAATAAACTCGAGTTTATTCCGCTTGCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031384.1-2458s1c1
Sequence:CCGGCCTGCATACTATCCTACTATTCTCGAGAATAGTAGGATAGTATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-1540s1c1
Sequence:CCGGGCCATAGCAGAAGTTGAGCAACTCGAGTTGCTCAACTTCTGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031384.1-1075s1c1
Sequence:CCGGGCTGCTAAGGAAATACTATATCTCGAGATATAGTATTTCCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-1379s1c1
Sequence:CCGGCCAGAAGTGTTAAGGTCCAAACTCGAGTTTGGACCTTAACACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-2584s1c1
Sequence:CCGGGCAGATGAAGTATGGAATATACTCGAGTATATTCCATACTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031384.1-3071s1c1
Sequence:CCGGCAGTGGAGAGTCATAATGATTCTCGAGAATCATTATGACTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-385s1c1
Sequence:CCGGGCAGCTAAACTGTGTTATATTCTCGAGAATATAACACAGTTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031384
TEX11 MISSION shRNA Lentiviral Transduction Particles
testis expressed 11
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031384.1-796s1c1
Sequence:CCGGGAAGCAAGCAAGCGGAATAAACTCGAGTTTATTCCGCTTGCTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031384.1-2458s1c1
Sequence:CCGGCCTGCATACTATCCTACTATTCTCGAGAATAGTAGGATAGTATGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-1540s1c1
Sequence:CCGGGCCATAGCAGAAGTTGAGCAACTCGAGTTGCTCAACTTCTGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031384.1-1075s1c1
Sequence:CCGGGCTGCTAAGGAAATACTATATCTCGAGATATAGTATTTCCTTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-1379s1c1
Sequence:CCGGCCAGAAGTGTTAAGGTCCAAACTCGAGTTTGGACCTTAACACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-2584s1c1
Sequence:CCGGGCAGATGAAGTATGGAATATACTCGAGTATATTCCATACTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031384.1-3071s1c1
Sequence:CCGGCAGTGGAGAGTCATAATGATTCTCGAGAATCATTATGACTCTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031384.1-385s1c1
Sequence:CCGGGCAGCTAAACTGTGTTATATTCTCGAGAATATAACACAGTTTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks