EMAIL THIS PAGE TO A FRIEND

TEX12

testis expressed 12

UniProtKB ID: Q9BXU0, A6NDL9, B0YIX3
Gene ID:
Human(56158) Summary: This gene is similar to a mouse gene that is expressed in the testis. [provided by RefSeq, Jul 2008]
Mouse(66654) testis expressed gene 12
Rat(690393) testis expressed 12
chicken(771186) testis expressed 12
domestic cat(101095516) testis expressed 12
dog(611341) testis expressed 12
domestic guinea pig(100734172) testis expressed 12
naked mole-rat(101703650) testis expressed 12
cow(506012) testis expressed 12
sheep(101111998) testis expressed 12
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031275 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031275 Rosetta Predictions human pricing
XM_001074312 Rosetta Predictions rat pricing
NM_025687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169803 predicted 620
2 SASI_Hs01_00169804 predicted 505
3 SASI_Hs01_00169805 predicted 278
4 SASI_Hs01_00169806 predicted 447
5 SASI_Hs01_00169807 predicted 278
6 SASI_Hs01_00169808 predicted 280
7 SASI_Hs01_00169809 predicted 461
8 SASI_Hs01_00169810 predicted 297
9 SASI_Hs01_00169811 predicted 390
10 SASI_Hs02_00358691 predicted 514
11 SASI_Hs01_00169812 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345762 predicted 746
2 SASI_Rn02_00345763 predicted 645
3 SASI_Rn02_00345764 predicted 572
4 SASI_Rn02_00345765 predicted 710
5 SASI_Rn02_00345766 predicted 468
6 SASI_Rn02_00345767 predicted 495
7 SASI_Rn02_00345768 predicted 834
8 SASI_Rn02_00345769 predicted 516
9 SASI_Rn02_00345770 predicted 824
10 SASI_Rn02_00345771 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143142 predicted 319
2 SASI_Mm01_00143143 predicted 395
3 SASI_Mm02_00328833 predicted 363
4 SASI_Mm01_00143147 predicted 219
5 SASI_Mm02_00328834 predicted 228
6 SASI_Mm01_00143149 predicted 300
7 SASI_Mm01_00143150 predicted 203
8 SASI_Mm01_00143151 predicted 225
9 SASI_Mm02_00328835 predicted 220
10 SASI_Mm02_00328836 predicted 306
11 SASI_Mm01_00143144 predicted 433
12 SASI_Mm01_00143145 predicted 617
13 SASI_Mm01_00143146 predicted 516
14 SASI_Mm01_00143148 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031275
TEX12 MISSION shRNA Bacterial Glycerol Stock
testis expressed 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-403s1c1
Sequence:CCGGGAACTCTTCAAAGAAGCCAATCTCGAGATTGGCTTCTTTGAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-328s1c1
Sequence:CCGGCTAATGTTGTCTACCTATGCACTCGAGTGCATAGGTAGACAACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-286s1c1
Sequence:CCGGGCCTTGGAGAAAGATTTAAATCTCGAGATTTAAATCTTTCTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-394s1c1
Sequence:CCGGGAGATAGATGAACTCTTCAAACTCGAGTTTGAAGAGTTCATCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-307s1c1
Sequence:CCGGGATGTGAGCAAGGAAATTAATCTCGAGATTAATTTCCTTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031275.4-484s21c1
Sequence:CCGGGCAAACACATTACACAGATAACTCGAGTTATCTGTGTAATGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031275.4-814s21c1
Sequence:CCGGCCTTAAACTTCTTAGTGTTTCCTCGAGGAAACACTAAGAAGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031275
TEX12 MISSION shRNA shRNA Plasmid DNA
testis expressed 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-403s1c1
Sequence:CCGGGAACTCTTCAAAGAAGCCAATCTCGAGATTGGCTTCTTTGAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-328s1c1
Sequence:CCGGCTAATGTTGTCTACCTATGCACTCGAGTGCATAGGTAGACAACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-286s1c1
Sequence:CCGGGCCTTGGAGAAAGATTTAAATCTCGAGATTTAAATCTTTCTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-394s1c1
Sequence:CCGGGAGATAGATGAACTCTTCAAACTCGAGTTTGAAGAGTTCATCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-307s1c1
Sequence:CCGGGATGTGAGCAAGGAAATTAATCTCGAGATTAATTTCCTTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031275.4-484s21c1
Sequence:CCGGGCAAACACATTACACAGATAACTCGAGTTATCTGTGTAATGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031275.4-814s21c1
Sequence:CCGGCCTTAAACTTCTTAGTGTTTCCTCGAGGAAACACTAAGAAGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031275
TEX12 MISSION shRNA Lentiviral Transduction Particles
testis expressed 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-403s1c1
Sequence:CCGGGAACTCTTCAAAGAAGCCAATCTCGAGATTGGCTTCTTTGAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-328s1c1
Sequence:CCGGCTAATGTTGTCTACCTATGCACTCGAGTGCATAGGTAGACAACATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-286s1c1
Sequence:CCGGGCCTTGGAGAAAGATTTAAATCTCGAGATTTAAATCTTTCTCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-394s1c1
Sequence:CCGGGAGATAGATGAACTCTTCAAACTCGAGTTTGAAGAGTTCATCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031275.3-307s1c1
Sequence:CCGGGATGTGAGCAAGGAAATTAATCTCGAGATTAATTTCCTTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031275.4-484s21c1
Sequence:CCGGGCAAACACATTACACAGATAACTCGAGTTATCTGTGTAATGTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412338    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031275.4-814s21c1
Sequence:CCGGCCTTAAACTTCTTAGTGTTTCCTCGAGGAAACACTAAGAAGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025687
TEX12 MISSION shRNA Bacterial Glycerol Stock
testis expressed 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025687.1-350s1c1
Sequence:CCGGGCATCTTACATCGATGAGATACTCGAGTATCTCATCGATGTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183234    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025687.1-514s1c1
Sequence:CCGGGTGTTCTTCTTGCTAGAGAAACTCGAGTTTCTCTAGCAAGAAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-281s21c1
Sequence:CCGGGCAGCAGTAGATGCATCTTACCTCGAGGTAAGATGCATCTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025687.3-376s1c1
Sequence:CCGGGAAGCAGAGGTTTACAGTAATCTCGAGATTACTGTAAACCTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025687.3-120s1c1
Sequence:CCGGCTGATAGTCCACAGGTATCTTCTCGAGAAGATACCTGTGGACTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-321s21c1
Sequence:CCGGTCTTCAAAGAAGCCAATATTACTCGAGTAATATTGGCTTCTTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025687.3-447s21c1
Sequence:CCGGTGTTACTGCTGTGTTCTTCTTCTCGAGAAGAAGAACACAGCAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-205s21c1
Sequence:CCGGGGAGAAGGATTTGAGCGATATCTCGAGATATCGCTCAAATCCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-400s21c1
Sequence:CCGGCAACACCCTACACAAGTAATGCTCGAGCATTACTTGTGTAGGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025687
TEX12 MISSION shRNA shRNA Plasmid DNA
testis expressed 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025687.1-350s1c1
Sequence:CCGGGCATCTTACATCGATGAGATACTCGAGTATCTCATCGATGTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183234    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025687.1-514s1c1
Sequence:CCGGGTGTTCTTCTTGCTAGAGAAACTCGAGTTTCTCTAGCAAGAAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-281s21c1
Sequence:CCGGGCAGCAGTAGATGCATCTTACCTCGAGGTAAGATGCATCTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025687.3-376s1c1
Sequence:CCGGGAAGCAGAGGTTTACAGTAATCTCGAGATTACTGTAAACCTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025687.3-120s1c1
Sequence:CCGGCTGATAGTCCACAGGTATCTTCTCGAGAAGATACCTGTGGACTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-321s21c1
Sequence:CCGGTCTTCAAAGAAGCCAATATTACTCGAGTAATATTGGCTTCTTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025687.3-447s21c1
Sequence:CCGGTGTTACTGCTGTGTTCTTCTTCTCGAGAAGAAGAACACAGCAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-205s21c1
Sequence:CCGGGGAGAAGGATTTGAGCGATATCTCGAGATATCGCTCAAATCCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-400s21c1
Sequence:CCGGCAACACCCTACACAAGTAATGCTCGAGCATTACTTGTGTAGGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025687
TEX12 MISSION shRNA Lentiviral Transduction Particles
testis expressed 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025687.1-350s1c1
Sequence:CCGGGCATCTTACATCGATGAGATACTCGAGTATCTCATCGATGTAAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183234    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025687.1-514s1c1
Sequence:CCGGGTGTTCTTCTTGCTAGAGAAACTCGAGTTTCTCTAGCAAGAAGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-281s21c1
Sequence:CCGGGCAGCAGTAGATGCATCTTACCTCGAGGTAAGATGCATCTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025687.3-376s1c1
Sequence:CCGGGAAGCAGAGGTTTACAGTAATCTCGAGATTACTGTAAACCTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025687.3-120s1c1
Sequence:CCGGCTGATAGTCCACAGGTATCTTCTCGAGAAGATACCTGTGGACTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-321s21c1
Sequence:CCGGTCTTCAAAGAAGCCAATATTACTCGAGTAATATTGGCTTCTTTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025687.3-447s21c1
Sequence:CCGGTGTTACTGCTGTGTTCTTCTTCTCGAGAAGAAGAACACAGCAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-205s21c1
Sequence:CCGGGGAGAAGGATTTGAGCGATATCTCGAGATATCGCTCAAATCCTTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025687.3-400s21c1
Sequence:CCGGCAACACCCTACACAAGTAATGCTCGAGCATTACTTGTGTAGGGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks