EMAIL THIS PAGE TO A FRIEND

TEX13A

testis expressed 13A

UniProtKB ID: Q9BXU3, B1B1G8, Q32NB6
Gene ID:
Human(56157) Summary: This gene is similar to a mouse gene that is expressed in the testis. [provided by RefSeq, Jul 2008]
Mouse(67944) testis expressed 13A
Rat(100362891) testis expressed 13A
cow(101903452) testis expressed 13A
dog(492058) testis expressed 13A
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026469 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026469 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026469 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031274 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143021 MISSION® esiRNA esiRNA human TEX13A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031274 Rosetta Predictions human pricing
NM_026469 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121057 predicted 852
2 SASI_Hs01_00121058 predicted 902
3 SASI_Hs01_00121059 predicted 919
4 SASI_Hs01_00121061 predicted 1121
5 SASI_Hs01_00121062 predicted 913
6 SASI_Hs01_00121063 predicted 901
7 SASI_Hs01_00121064 predicted 967
8 SASI_Hs01_00121065 predicted 492
9 SASI_Hs02_00358689 predicted 915
10 SASI_Hs02_00358690 predicted 1078
11 SASI_Hs01_00121056 predicted 827
12 SASI_Hs01_00121060 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330328 predicted 1081
2 SASI_Mm02_00330329 predicted 237
3 SASI_Mm02_00330330 predicted 677
4 SASI_Mm02_00330331 predicted 674
5 SASI_Mm02_00330332 predicted 660
6 SASI_Mm02_00330333 predicted 1055
7 SASI_Mm02_00330334 predicted 507
8 SASI_Mm02_00330335 predicted 197
9 SASI_Mm02_00330336 predicted 308
10 SASI_Mm02_00330337 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026469
TEX13A MISSION shRNA Bacterial Glycerol Stock
testis expressed 13A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000196060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-241s1c1
Sequence:CCGGGTGTCCTCTGAGCCCTTTATTCTCGAGAATAAAGGGCTCAGAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-206s1c1
Sequence:CCGGGCTCTTTCTCTCAGTCCCTAACTCGAGTTAGGGACTGAGAGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-353s1c1
Sequence:CCGGCTCATGTGTATCCCTATTCTACTCGAGTAGAATAGGGATACACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-215s1c1
Sequence:CCGGCTCAGTCCCTAAATCTGAGATCTCGAGATCTCAGATTTAGGGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026469
TEX13A MISSION shRNA shRNA Plasmid DNA
testis expressed 13A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000196060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-241s1c1
Sequence:CCGGGTGTCCTCTGAGCCCTTTATTCTCGAGAATAAAGGGCTCAGAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-206s1c1
Sequence:CCGGGCTCTTTCTCTCAGTCCCTAACTCGAGTTAGGGACTGAGAGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-353s1c1
Sequence:CCGGCTCATGTGTATCCCTATTCTACTCGAGTAGAATAGGGATACACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-215s1c1
Sequence:CCGGCTCAGTCCCTAAATCTGAGATCTCGAGATCTCAGATTTAGGGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026469
TEX13A MISSION shRNA Lentiviral Transduction Particles
testis expressed 13A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000196060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-241s1c1
Sequence:CCGGGTGTCCTCTGAGCCCTTTATTCTCGAGAATAAAGGGCTCAGAGGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-206s1c1
Sequence:CCGGGCTCTTTCTCTCAGTCCCTAACTCGAGTTAGGGACTGAGAGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-353s1c1
Sequence:CCGGCTCATGTGTATCCCTATTCTACTCGAGTAGAATAGGGATACACATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026469.1-215s1c1
Sequence:CCGGCTCAGTCCCTAAATCTGAGATCTCGAGATCTCAGATTTAGGGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031274
TEX13A MISSION shRNA Bacterial Glycerol Stock
testis expressed 13A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-1211s1c1
Sequence:CCGGCATCAGCAAAGACCTCCAGTACTCGAGTACTGGAGGTCTTTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-930s1c1
Sequence:CCGGCCACATCTTATTTCTCTGGAACTCGAGTTCCAGAGAAATAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-207s1c1
Sequence:CCGGCCGAGTTCTATCTTGAGAATACTCGAGTATTCTCAAGATAGAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-206s1c1
Sequence:CCGGCCCGAGTTCTATCTTGAGAATCTCGAGATTCTCAAGATAGAACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031274.2-529s1c1
Sequence:CCGGGCAGAAAGAGAGAGACAAGGACTCGAGTCCTTGTCTCTCTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031274.2-1014s1c1
Sequence:CCGGCATACTCATACTCAAGCCCTTCTCGAGAAGGGCTTGAGTATGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-396s1c1
Sequence:CCGGGCTTCGCCAAACTGCACAAATCTCGAGATTTGTGCAGTTTGGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031274.3-1006s21c1
Sequence:CCGGCTCATACTCATACTCATACTCCTCGAGGAGTATGAGTATGAGTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031274.3-1130s21c1
Sequence:CCGGGATACTAGCCTGTGGTCTGATCTCGAGATCAGACCACAGGCTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031274
TEX13A MISSION shRNA shRNA Plasmid DNA
testis expressed 13A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-1211s1c1
Sequence:CCGGCATCAGCAAAGACCTCCAGTACTCGAGTACTGGAGGTCTTTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-930s1c1
Sequence:CCGGCCACATCTTATTTCTCTGGAACTCGAGTTCCAGAGAAATAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-207s1c1
Sequence:CCGGCCGAGTTCTATCTTGAGAATACTCGAGTATTCTCAAGATAGAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-206s1c1
Sequence:CCGGCCCGAGTTCTATCTTGAGAATCTCGAGATTCTCAAGATAGAACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031274.2-529s1c1
Sequence:CCGGGCAGAAAGAGAGAGACAAGGACTCGAGTCCTTGTCTCTCTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031274.2-1014s1c1
Sequence:CCGGCATACTCATACTCAAGCCCTTCTCGAGAAGGGCTTGAGTATGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-396s1c1
Sequence:CCGGGCTTCGCCAAACTGCACAAATCTCGAGATTTGTGCAGTTTGGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031274.3-1006s21c1
Sequence:CCGGCTCATACTCATACTCATACTCCTCGAGGAGTATGAGTATGAGTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031274.3-1130s21c1
Sequence:CCGGGATACTAGCCTGTGGTCTGATCTCGAGATCAGACCACAGGCTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031274
TEX13A MISSION shRNA Lentiviral Transduction Particles
testis expressed 13A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-1211s1c1
Sequence:CCGGCATCAGCAAAGACCTCCAGTACTCGAGTACTGGAGGTCTTTGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-930s1c1
Sequence:CCGGCCACATCTTATTTCTCTGGAACTCGAGTTCCAGAGAAATAAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-207s1c1
Sequence:CCGGCCGAGTTCTATCTTGAGAATACTCGAGTATTCTCAAGATAGAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-206s1c1
Sequence:CCGGCCCGAGTTCTATCTTGAGAATCTCGAGATTCTCAAGATAGAACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031274.2-529s1c1
Sequence:CCGGGCAGAAAGAGAGAGACAAGGACTCGAGTCCTTGTCTCTCTCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031274.2-1014s1c1
Sequence:CCGGCATACTCATACTCAAGCCCTTCTCGAGAAGGGCTTGAGTATGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031274.2-396s1c1
Sequence:CCGGGCTTCGCCAAACTGCACAAATCTCGAGATTTGTGCAGTTTGGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031274.3-1006s21c1
Sequence:CCGGCTCATACTCATACTCATACTCCTCGAGGAGTATGAGTATGAGTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031274.3-1130s21c1
Sequence:CCGGGATACTAGCCTGTGGTCTGATCTCGAGATCAGACCACAGGCTAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks