EMAIL THIS PAGE TO A FRIEND

TEX13B

testis expressed 13B

Synonyms: TGC3B TSGA5
UniProtKB ID: Q9BXU2, Q5JYF6
Gene ID:
Human(56156) Summary: This gene is similar to a mouse gene that is expressed in the testis. [provided by RefSeq, Jul 2008]
Rat(680865) testis expressed 13B
cow(518298) testis expressed 13B
sheep(101115101) testis expressed 13B
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031273 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031273 Rosetta Predictions human pricing
XM_001059222 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091365 predicted 934
2 SASI_Hs01_00091366 predicted 990
3 SASI_Hs01_00091367 predicted 762
4 SASI_Hs01_00091368 predicted 985
5 SASI_Hs01_00091370 predicted 801
6 SASI_Hs01_00091372 predicted 413
7 SASI_Hs01_00091374 predicted 979
8 SASI_Hs02_00358686 predicted 520
9 SASI_Hs02_00358687 predicted 985
10 SASI_Hs02_00358688 predicted 936
11 SASI_Hs01_00091369 predicted 765
12 SASI_Hs01_00091371 predicted 823
13 SASI_Hs01_00091373 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292474 predicted 421
2 SASI_Rn02_00292475 predicted 320
3 SASI_Rn02_00292476 predicted 379
4 SASI_Rn02_00292477 predicted 454
5 SASI_Rn02_00292478 predicted 207
6 SASI_Rn02_00292479 predicted 276
7 SASI_Rn02_00292480 predicted 315
8 SASI_Rn02_00292481 predicted 464
9 SASI_Rn02_00292482 predicted 413
10 SASI_Rn02_00292483 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031273
TEX13B MISSION shRNA Bacterial Glycerol Stock
testis expressed 13B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-188s21c1
Sequence:CCGGCCGAGTTCTACTTCGAGAATACTCGAGTATTCTCGAAGTAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031273.2-1060s21c1
Sequence:CCGGCCAGGGAATAGACCCTCAAGACTCGAGTCTTGAGGGTCTATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-772s21c1
Sequence:CCGGGCTATTGTAGCAGGCAAATTACTCGAGTAATTTGCCTGCTACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-945s21c1
Sequence:CCGGTCTCAGCCATACCCAATATACCTCGAGGTATATTGGGTATGGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-817s21c1
Sequence:CCGGAGATCTCAGGTCAGTACAAACCTCGAGGTTTGTACTGACCTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031273.1-823s1c1
Sequence:CCGGCAGGTCAGTACAAACAGCCATCTCGAGATGGCTGTTTGTACTGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031273.1-377s1c1
Sequence:CCGGGCTTTGCCAAACTGCACAGATCTCGAGATCTGTGCAGTTTGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031273
TEX13B MISSION shRNA shRNA Plasmid DNA
testis expressed 13B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-188s21c1
Sequence:CCGGCCGAGTTCTACTTCGAGAATACTCGAGTATTCTCGAAGTAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031273.2-1060s21c1
Sequence:CCGGCCAGGGAATAGACCCTCAAGACTCGAGTCTTGAGGGTCTATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-772s21c1
Sequence:CCGGGCTATTGTAGCAGGCAAATTACTCGAGTAATTTGCCTGCTACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-945s21c1
Sequence:CCGGTCTCAGCCATACCCAATATACCTCGAGGTATATTGGGTATGGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-817s21c1
Sequence:CCGGAGATCTCAGGTCAGTACAAACCTCGAGGTTTGTACTGACCTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031273.1-823s1c1
Sequence:CCGGCAGGTCAGTACAAACAGCCATCTCGAGATGGCTGTTTGTACTGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031273.1-377s1c1
Sequence:CCGGGCTTTGCCAAACTGCACAGATCTCGAGATCTGTGCAGTTTGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031273
TEX13B MISSION shRNA Lentiviral Transduction Particles
testis expressed 13B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-188s21c1
Sequence:CCGGCCGAGTTCTACTTCGAGAATACTCGAGTATTCTCGAAGTAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031273.2-1060s21c1
Sequence:CCGGCCAGGGAATAGACCCTCAAGACTCGAGTCTTGAGGGTCTATTCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-772s21c1
Sequence:CCGGGCTATTGTAGCAGGCAAATTACTCGAGTAATTTGCCTGCTACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-945s21c1
Sequence:CCGGTCTCAGCCATACCCAATATACCTCGAGGTATATTGGGTATGGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031273.2-817s21c1
Sequence:CCGGAGATCTCAGGTCAGTACAAACCTCGAGGTTTGTACTGACCTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031273.1-823s1c1
Sequence:CCGGCAGGTCAGTACAAACAGCCATCTCGAGATGGCTGTTTGTACTGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031273.1-377s1c1
Sequence:CCGGGCTTTGCCAAACTGCACAGATCTCGAGATCTGTGCAGTTTGGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks