EMAIL THIS PAGE TO A FRIEND

TEX14

testis expressed 14

Synonyms: CT113
UniProtKB ID: Q8IWB6, A6NH19, Q7RTP3, Q8ND97, Q9BXT9
Gene ID:
Human(56155) Summary: The protein encoded by this gene is necessary for intercellular bridges in germ cells, which are required for spermatogenesis. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2011]
Mouse(83560) testis expressed gene 14
Rat(287603) testis expressed 14
cow(522810) testis expressed 14
sheep(101102402) testis expressed 14
domestic guinea pig(100727033) testis expressed 14
naked mole-rat(101715712) testis expressed 14
chicken(417625) testis expressed 14
dog(480572) testis expressed 14
domestic cat(101096273) testis expressed 14
Horse(100057035) testis expressed 14
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031272 Rosetta Predictions human pricing
NM_198393 Rosetta Predictions human pricing
XM_001081119 Rosetta Predictions rat pricing
XM_220825 Rosetta Predictions rat pricing
NM_031386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162396 predicted 2324
2 SASI_Hs01_00162397 predicted 4506
3 SASI_Hs01_00162398 predicted 299
4 SASI_Hs01_00162399 predicted 3058
5 SASI_Hs01_00162401 predicted 691
6 SASI_Hs01_00162402 predicted 1544
7 SASI_Hs01_00162403 predicted 1715
8 SASI_Hs01_00162404 predicted 1470
9 SASI_Hs02_00358684 predicted 3812
10 SASI_Hs02_00358685 predicted 3495
11 SASI_Hs01_00162400 predicted 267
12 SASI_Hs01_00162405 predicted 4414
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204457 predicted 2323
2 SASI_Hs01_00204458 predicted 4626
3 SASI_Hs01_00204459 predicted 307
4 SASI_Hs01_00204460 predicted 3056
5 SASI_Hs01_00204462 predicted 696
6 SASI_Hs01_00204463 predicted 1550
7 SASI_Hs01_00204464 predicted 1718
8 SASI_Hs01_00204465 predicted 1467
9 SASI_Hs02_00371911 predicted 3929
10 SASI_Hs02_00371912 predicted 3610
11 SASI_Hs01_00204461 predicted 271
12 SASI_Hs01_00204466 predicted 4533
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370615 predicted 3073
2 SASI_Rn02_00370616 predicted 2183
3 SASI_Rn02_00370617 predicted 3738
4 SASI_Rn02_00370618 predicted 688
5 SASI_Rn02_00370619 predicted 3261
6 SASI_Rn02_00370620 predicted 2942
7 SASI_Rn02_00370621 predicted 328
8 SASI_Rn02_00370622 predicted 3754
9 SASI_Rn02_00370623 predicted 2476
10 SASI_Rn02_00370624 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379554 predicted 331
2 SASI_Rn02_00379555 predicted 353
3 SASI_Rn02_00379556 predicted 346
4 SASI_Rn02_00379557 predicted 334
5 SASI_Rn02_00379558 predicted 240
6 SASI_Rn02_00379559 predicted 511
7 SASI_Rn02_00379560 predicted 204
8 SASI_Rn02_00379561 predicted 292
9 SASI_Rn02_00379562 predicted 325
10 SASI_Rn02_00379563 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110225 predicted 1429
2 SASI_Mm01_00110226 predicted 3756
3 SASI_Mm01_00110229 predicted 3763
4 SASI_Mm01_00110230 predicted 3820
5 SASI_Mm01_00110231 predicted 2286
6 SASI_Mm01_00110232 predicted 1764
7 SASI_Mm02_00337131 predicted 601
8 SASI_Mm01_00110233 predicted 3296
9 SASI_Mm02_00337132 predicted 333
10 SASI_Mm01_00110234 predicted 3517
11 SASI_Mm01_00110227 predicted 3359
12 SASI_Mm01_00110228 predicted 699
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031272
TEX14 MISSION shRNA Bacterial Glycerol Stock
testis expressed 14
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-3497s1c1
Sequence:CCGGGACATATCATTGACGGATATTCTCGAGAATATCCGTCAATGATATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-3099s1c1
Sequence:CCGGCCAGAGGAAATGGCAAGTTTGCTCGAGCAAACTTGCCATTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-1713s1c1
Sequence:CCGGCCGATGTCAATGTCTATCTAGCTCGAGCTAGATAGACATTGACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-153s1c1
Sequence:CCGGCTGTTCAACTTGGTACCTTAACTCGAGTTAAGGTACCAAGTTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-2329s1c1
Sequence:CCGGGCAGACAATAATGCACGAGAACTCGAGTTCTCGTGCATTATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-3510s1c1
Sequence:CCGGCGGATATTCAAGACCTGTCTACTCGAGTAGACAGGTCTTGAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-1541s1c1
Sequence:CCGGCCGAAACCTTACTATGATATTCTCGAGAATATCATAGTAAGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-2566s1c1
Sequence:CCGGCCTACCAAGATTTCCAAGAATCTCGAGATTCTTGGAAATCTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-707s1c1
Sequence:CCGGGCTGGAGTCATTTCTGCTCAACTCGAGTTGAGCAGAAATGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-1607s21c1
Sequence:CCGGCTTCAAGATATCCGGTATATTCTCGAGAATATACCGGATATCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031272.3-4578s21c1
Sequence:GTACCGGAGTTCTGTAAGTCTCACTTTGCTCGAGCAAAGTGAGACTTACAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-2363s21c1
Sequence:GTACCGGAGGAATATCGAGCAGATATTACTCGAGTAATATCTGCTCGATATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-2877s21c1
Sequence:GTACCGGATGATGGAAAGGTACACTTAACTCGAGTTAAGTGTACCTTTCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-3053s21c1
Sequence:CCGGACGGATTGGCAGCGAGTTATTCTCGAGAATAACTCGCTGCCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031272
TEX14 MISSION shRNA shRNA Plasmid DNA
testis expressed 14
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-3497s1c1
Sequence:CCGGGACATATCATTGACGGATATTCTCGAGAATATCCGTCAATGATATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-3099s1c1
Sequence:CCGGCCAGAGGAAATGGCAAGTTTGCTCGAGCAAACTTGCCATTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-1713s1c1
Sequence:CCGGCCGATGTCAATGTCTATCTAGCTCGAGCTAGATAGACATTGACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-153s1c1
Sequence:CCGGCTGTTCAACTTGGTACCTTAACTCGAGTTAAGGTACCAAGTTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-2329s1c1
Sequence:CCGGGCAGACAATAATGCACGAGAACTCGAGTTCTCGTGCATTATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-3510s1c1
Sequence:CCGGCGGATATTCAAGACCTGTCTACTCGAGTAGACAGGTCTTGAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-1541s1c1
Sequence:CCGGCCGAAACCTTACTATGATATTCTCGAGAATATCATAGTAAGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-2566s1c1
Sequence:CCGGCCTACCAAGATTTCCAAGAATCTCGAGATTCTTGGAAATCTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-707s1c1
Sequence:CCGGGCTGGAGTCATTTCTGCTCAACTCGAGTTGAGCAGAAATGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-1607s21c1
Sequence:CCGGCTTCAAGATATCCGGTATATTCTCGAGAATATACCGGATATCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031272.3-4578s21c1
Sequence:GTACCGGAGTTCTGTAAGTCTCACTTTGCTCGAGCAAAGTGAGACTTACAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-2363s21c1
Sequence:GTACCGGAGGAATATCGAGCAGATATTACTCGAGTAATATCTGCTCGATATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-2877s21c1
Sequence:GTACCGGATGATGGAAAGGTACACTTAACTCGAGTTAAGTGTACCTTTCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-3053s21c1
Sequence:CCGGACGGATTGGCAGCGAGTTATTCTCGAGAATAACTCGCTGCCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031272
TEX14 MISSION shRNA Lentiviral Transduction Particles
testis expressed 14
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-3497s1c1
Sequence:CCGGGACATATCATTGACGGATATTCTCGAGAATATCCGTCAATGATATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195685    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-3099s1c1
Sequence:CCGGCCAGAGGAAATGGCAAGTTTGCTCGAGCAAACTTGCCATTTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195135    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-1713s1c1
Sequence:CCGGCCGATGTCAATGTCTATCTAGCTCGAGCTAGATAGACATTGACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031272.3-153s1c1
Sequence:CCGGCTGTTCAACTTGGTACCTTAACTCGAGTTAAGGTACCAAGTTGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-2329s1c1
Sequence:CCGGGCAGACAATAATGCACGAGAACTCGAGTTCTCGTGCATTATTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-3510s1c1
Sequence:CCGGCGGATATTCAAGACCTGTCTACTCGAGTAGACAGGTCTTGAATATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-1541s1c1
Sequence:CCGGCCGAAACCTTACTATGATATTCTCGAGAATATCATAGTAAGGTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-2566s1c1
Sequence:CCGGCCTACCAAGATTTCCAAGAATCTCGAGATTCTTGGAAATCTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031272.2-707s1c1
Sequence:CCGGGCTGGAGTCATTTCTGCTCAACTCGAGTTGAGCAGAAATGACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-1607s21c1
Sequence:CCGGCTTCAAGATATCCGGTATATTCTCGAGAATATACCGGATATCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031272.3-4578s21c1
Sequence:GTACCGGAGTTCTGTAAGTCTCACTTTGCTCGAGCAAAGTGAGACTTACAGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-2363s21c1
Sequence:GTACCGGAGGAATATCGAGCAGATATTACTCGAGTAATATCTGCTCGATATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-2877s21c1
Sequence:GTACCGGATGATGGAAAGGTACACTTAACTCGAGTTAAGTGTACCTTTCCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031272.3-3053s21c1
Sequence:CCGGACGGATTGGCAGCGAGTTATTCTCGAGAATAACTCGCTGCCAATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031386
VALIDATED
TEX14 MISSION shRNA Bacterial Glycerol Stock
testis expressed 14
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031386.1-1170s1c1
Sequence:CCGGCCGGAACCTTACTATGATATTCTCGAGAATATCATAGTAAGGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031386.1-4000s1c1
Sequence:CCGGCCTTGGAAGAAGATGAACTAACTCGAGTTAGTTCATCTTCTTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031386.1-2727s1c1
Sequence:CCGGCCCAAAGGAAATACGAAGTTTCTCGAGAAACTTCGTATTTCCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031386.1-2121s1c1
Sequence:CCGGCCTCCATCTTTGGCCTATCTTCTCGAGAAGATAGGCCAAAGATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031386.2-4569s21c1
Sequence:CCGGCTGCTACTATGGGCACAATAACTCGAGTTATTGTGCCCATAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3527s21c1
Sequence:GTACCGGCTATGATCAAGACGGCTATTTCTCGAGAAATAGCCGTCTTGATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-1595s21c1
Sequence:CCGGCCTTCAAGATATTCGTTATATCTCGAGATATAACGAATATCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031386.2-4604s21c1
Sequence:CCGGGTGTAGCATGCTTAATCATTTCTCGAGAAATGATTAAGCATGCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3859s21c1
Sequence:CCGGCTAACGTTTCTGCGGCATTTGCTCGAGCAAATGCCGCAGAAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3164s21c1
Sequence:CCGGCCAGCGCTTCACTGGTATTAGCTCGAGCTAATACCAGTGAAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-322s21c1
Sequence:CCGGTGGATGTTCTGGTGGATTATGCTCGAGCATAATCCACCAGAACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3607s21c1
Sequence:CCGGCGCTAAGCCCAGAGTCGATTTCTCGAGAAATCGACTCTGGGCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031386
VALIDATED
TEX14 MISSION shRNA shRNA Plasmid DNA
testis expressed 14
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031386.1-1170s1c1
Sequence:CCGGCCGGAACCTTACTATGATATTCTCGAGAATATCATAGTAAGGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031386.1-4000s1c1
Sequence:CCGGCCTTGGAAGAAGATGAACTAACTCGAGTTAGTTCATCTTCTTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031386.1-2727s1c1
Sequence:CCGGCCCAAAGGAAATACGAAGTTTCTCGAGAAACTTCGTATTTCCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031386.1-2121s1c1
Sequence:CCGGCCTCCATCTTTGGCCTATCTTCTCGAGAAGATAGGCCAAAGATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031386.2-4569s21c1
Sequence:CCGGCTGCTACTATGGGCACAATAACTCGAGTTATTGTGCCCATAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3527s21c1
Sequence:GTACCGGCTATGATCAAGACGGCTATTTCTCGAGAAATAGCCGTCTTGATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-1595s21c1
Sequence:CCGGCCTTCAAGATATTCGTTATATCTCGAGATATAACGAATATCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031386.2-4604s21c1
Sequence:CCGGGTGTAGCATGCTTAATCATTTCTCGAGAAATGATTAAGCATGCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3859s21c1
Sequence:CCGGCTAACGTTTCTGCGGCATTTGCTCGAGCAAATGCCGCAGAAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3164s21c1
Sequence:CCGGCCAGCGCTTCACTGGTATTAGCTCGAGCTAATACCAGTGAAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-322s21c1
Sequence:CCGGTGGATGTTCTGGTGGATTATGCTCGAGCATAATCCACCAGAACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3607s21c1
Sequence:CCGGCGCTAAGCCCAGAGTCGATTTCTCGAGAAATCGACTCTGGGCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031386
VALIDATED
TEX14 MISSION shRNA Lentiviral Transduction Particles
testis expressed 14
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031386.1-1170s1c1
Sequence:CCGGCCGGAACCTTACTATGATATTCTCGAGAATATCATAGTAAGGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031386.1-4000s1c1
Sequence:CCGGCCTTGGAAGAAGATGAACTAACTCGAGTTAGTTCATCTTCTTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031386.1-2727s1c1
Sequence:CCGGCCCAAAGGAAATACGAAGTTTCTCGAGAAACTTCGTATTTCCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031386.1-2121s1c1
Sequence:CCGGCCTCCATCTTTGGCCTATCTTCTCGAGAAGATAGGCCAAAGATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031386.2-4569s21c1
Sequence:CCGGCTGCTACTATGGGCACAATAACTCGAGTTATTGTGCCCATAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3527s21c1
Sequence:GTACCGGCTATGATCAAGACGGCTATTTCTCGAGAAATAGCCGTCTTGATCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-1595s21c1
Sequence:CCGGCCTTCAAGATATTCGTTATATCTCGAGATATAACGAATATCTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031386.2-4604s21c1
Sequence:CCGGGTGTAGCATGCTTAATCATTTCTCGAGAAATGATTAAGCATGCTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3859s21c1
Sequence:CCGGCTAACGTTTCTGCGGCATTTGCTCGAGCAAATGCCGCAGAAACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3164s21c1
Sequence:CCGGCCAGCGCTTCACTGGTATTAGCTCGAGCTAATACCAGTGAAGCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-322s21c1
Sequence:CCGGTGGATGTTCTGGTGGATTATGCTCGAGCATAATCCACCAGAACATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031386.2-3607s21c1
Sequence:CCGGCGCTAAGCCCAGAGTCGATTTCTCGAGAAATCGACTCTGGGCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks