EMAIL THIS PAGE TO A FRIEND

TEX15

testis expressed 15

Synonyms: CT42
UniProtKB ID: Q9BXT5
Gene ID:
Mouse(104271) testis expressed gene 15
Rat(290803) testis expressed 15
dog(100686345) testis expressed 15
Horse(100062191) testis expressed 15
domestic cat(101094922) testis expressed 15
naked mole-rat(101725833) testis expressed 15
domestic guinea pig(100719345) testis expressed 15
cow(785886) testis expressed 15
sheep(101115182) testis expressed 15
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031271 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031271 Rosetta Predictions human pricing
NM_001106087 Rosetta Predictions rat pricing
NM_031374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232287 predicted 3836
2 SASI_Hs01_00232288 predicted 4154
3 SASI_Hs02_00358680 predicted 4989
4 SASI_Hs02_00358681 predicted 2524
5 SASI_Hs01_00232290 predicted 1604
6 SASI_Hs01_00232291 predicted 8024
7 SASI_Hs02_00358682 predicted 573
8 SASI_Hs02_00358683 predicted 3452
9 SASI_Hs01_00232292 predicted 5438
10 SASI_Hs01_00232293 predicted 5521
11 SASI_Hs01_00232289 predicted 5428
12 SASI_Hs01_00232294 predicted 6891
13 SASI_Hs01_00232295 predicted 4180
14 SASI_Hs01_00232296 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106087 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215502 predicted 6305
2 SASI_Rn02_00215503 predicted 2355
3 SASI_Rn02_00215504 predicted 3355
4 SASI_Rn02_00215505 predicted 5518
5 SASI_Rn02_00215506 predicted 1354
6 SASI_Rn02_00215507 predicted 2896
7 SASI_Rn02_00215508 predicted 1115
8 SASI_Rn02_00215509 predicted 3115
9 SASI_Rn02_00215510 predicted 2486
10 SASI_Rn02_00215511 predicted 3721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337114 predicted 5661
2 SASI_Mm01_00100245 predicted 6285
3 SASI_Mm01_00100246 predicted 690
4 SASI_Mm01_00100247 predicted 3623
5 SASI_Mm01_00100248 predicted 2441
6 SASI_Mm01_00100249 predicted 3024
7 SASI_Mm01_00100250 predicted 2338
8 SASI_Mm01_00100251 predicted 5862
9 SASI_Mm01_00100252 predicted 1370
10 SASI_Mm02_00337115 predicted 4871
11 SASI_Mm01_00100244 predicted 1688
12 SASI_Mm01_00100253 predicted 5426
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031271
TEX15 MISSION shRNA Bacterial Glycerol Stock
testis expressed 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-6774s1c1
Sequence:CCGGGCTGTATAACAGAAGGAAGATCTCGAGATCTTCCTTCTGTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144834    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031271.2-8862s1c1
Sequence:CCGGGCATAATCTCAGTGTTTCCTTCTCGAGAAGGAAACACTGAGATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-5362s1c1
Sequence:CCGGCGACAGGTTAATGAATGTGAACTCGAGTTCACATTCATTAACCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-7888s1c1
Sequence:CCGGGCCACATATTGGAATGAACTTCTCGAGAAGTTCATTCCAATATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-5866s1c1
Sequence:CCGGGCTTCCAGAAAGTCAGATCATCTCGAGATGATCTGACTTTCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031271.2-9260s1c1
Sequence:CCGGGCTCAACAGCTATTCCTGTTTCTCGAGAAACAGGAATAGCTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031271.2-9221s1c1
Sequence:CCGGGCAGTCTTGAGCTGTCTCTTTCTCGAGAAAGAGACAGCTCAAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031271.2-113s1c1
Sequence:CCGGGCTCAAGCACAGTCACTACTTCTCGAGAAGTAGTGACTGTGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031271.2-4822s1c1
Sequence:CCGGGCTAATCATACGGCCCTTATACTCGAGTATAAGGGCCGTATGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-3969s1c1
Sequence:CCGGCCTAACTTTGATAGCAAGTAACTCGAGTTACTTGCTATCAAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031271
TEX15 MISSION shRNA shRNA Plasmid DNA
testis expressed 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-6774s1c1
Sequence:CCGGGCTGTATAACAGAAGGAAGATCTCGAGATCTTCCTTCTGTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144834    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031271.2-8862s1c1
Sequence:CCGGGCATAATCTCAGTGTTTCCTTCTCGAGAAGGAAACACTGAGATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-5362s1c1
Sequence:CCGGCGACAGGTTAATGAATGTGAACTCGAGTTCACATTCATTAACCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-7888s1c1
Sequence:CCGGGCCACATATTGGAATGAACTTCTCGAGAAGTTCATTCCAATATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-5866s1c1
Sequence:CCGGGCTTCCAGAAAGTCAGATCATCTCGAGATGATCTGACTTTCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031271.2-9260s1c1
Sequence:CCGGGCTCAACAGCTATTCCTGTTTCTCGAGAAACAGGAATAGCTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031271.2-9221s1c1
Sequence:CCGGGCAGTCTTGAGCTGTCTCTTTCTCGAGAAAGAGACAGCTCAAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031271.2-113s1c1
Sequence:CCGGGCTCAAGCACAGTCACTACTTCTCGAGAAGTAGTGACTGTGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031271.2-4822s1c1
Sequence:CCGGGCTAATCATACGGCCCTTATACTCGAGTATAAGGGCCGTATGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-3969s1c1
Sequence:CCGGCCTAACTTTGATAGCAAGTAACTCGAGTTACTTGCTATCAAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031271
TEX15 MISSION shRNA Lentiviral Transduction Particles
testis expressed 15
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-6774s1c1
Sequence:CCGGGCTGTATAACAGAAGGAAGATCTCGAGATCTTCCTTCTGTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144834    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031271.2-8862s1c1
Sequence:CCGGGCATAATCTCAGTGTTTCCTTCTCGAGAAGGAAACACTGAGATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-5362s1c1
Sequence:CCGGCGACAGGTTAATGAATGTGAACTCGAGTTCACATTCATTAACCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-7888s1c1
Sequence:CCGGGCCACATATTGGAATGAACTTCTCGAGAAGTTCATTCCAATATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-5866s1c1
Sequence:CCGGGCTTCCAGAAAGTCAGATCATCTCGAGATGATCTGACTTTCTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143196    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031271.2-9260s1c1
Sequence:CCGGGCTCAACAGCTATTCCTGTTTCTCGAGAAACAGGAATAGCTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140146    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031271.2-9221s1c1
Sequence:CCGGGCAGTCTTGAGCTGTCTCTTTCTCGAGAAAGAGACAGCTCAAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031271.2-113s1c1
Sequence:CCGGGCTCAAGCACAGTCACTACTTCTCGAGAAGTAGTGACTGTGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031271.2-4822s1c1
Sequence:CCGGGCTAATCATACGGCCCTTATACTCGAGTATAAGGGCCGTATGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031271.2-3969s1c1
Sequence:CCGGCCTAACTTTGATAGCAAGTAACTCGAGTTACTTGCTATCAAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031374
TEX15 MISSION shRNA Bacterial Glycerol Stock
testis expressed 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-3556s1c1
Sequence:CCGGCCGGTATCAAAGCACAGATTACTCGAGTAATCTGTGCTTTGATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-1730s1c1
Sequence:CCGGGCCTATCTTATGATGCAGAATCTCGAGATTCTGCATCATAAGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-4786s1c1
Sequence:CCGGCCAGCCATTGTAGAAACTAATCTCGAGATTAGTTTCTACAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-6435s1c1
Sequence:CCGGGCTGGCTGTTATCTATGAATACTCGAGTATTCATAGATAACAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-620s1c1
Sequence:CCGGCGGAAGTTCCTGCTGATAATACTCGAGTATTATCAGCAGGAACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031374
TEX15 MISSION shRNA shRNA Plasmid DNA
testis expressed 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-3556s1c1
Sequence:CCGGCCGGTATCAAAGCACAGATTACTCGAGTAATCTGTGCTTTGATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-1730s1c1
Sequence:CCGGGCCTATCTTATGATGCAGAATCTCGAGATTCTGCATCATAAGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-4786s1c1
Sequence:CCGGCCAGCCATTGTAGAAACTAATCTCGAGATTAGTTTCTACAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-6435s1c1
Sequence:CCGGGCTGGCTGTTATCTATGAATACTCGAGTATTCATAGATAACAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-620s1c1
Sequence:CCGGCGGAAGTTCCTGCTGATAATACTCGAGTATTATCAGCAGGAACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031374
TEX15 MISSION shRNA Lentiviral Transduction Particles
testis expressed 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-3556s1c1
Sequence:CCGGCCGGTATCAAAGCACAGATTACTCGAGTAATCTGTGCTTTGATACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-1730s1c1
Sequence:CCGGGCCTATCTTATGATGCAGAATCTCGAGATTCTGCATCATAAGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-4786s1c1
Sequence:CCGGCCAGCCATTGTAGAAACTAATCTCGAGATTAGTTTCTACAATGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-6435s1c1
Sequence:CCGGGCTGGCTGTTATCTATGAATACTCGAGTATTCATAGATAACAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031374.1-620s1c1
Sequence:CCGGCGGAAGTTCCTGCTGATAATACTCGAGTATTATCAGCAGGAACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks