EMAIL THIS PAGE TO A FRIEND

TEX19

testis expressed 19

Species: Human TEX19(400629)
UniProtKB ID: Q8NA77
Gene ID:
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207459 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014321 MISSION® esiRNA esiRNA targeting human FLJ35767 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207459 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374090 predicted 399
2 SASI_Hs01_00244574 predicted 1160
3 SASI_Hs01_00244575 predicted 399
4 SASI_Hs01_00244576 predicted 1155
5 SASI_Hs01_00244577 predicted 1180
6 SASI_Hs01_00244578 predicted 1089
7 SASI_Hs01_00244579 predicted 743
8 SASI_Hs01_00244580 predicted 370
9 SASI_Hs01_00244581 predicted 738
10 SASI_Hs01_00244582 predicted 1175
11 SASI_Hs01_00244583 predicted 1201
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207459
TEX19 MISSION shRNA Bacterial Glycerol Stock
testis expressed 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-756s1c1
Sequence:CCGGGATTTGAGGAGCTTCTTACCTCTCGAGAGGTAAGAAGCTCCTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207459.1-1436s1c1
Sequence:CCGGCCAGCAATTGCTGTTCCACAACTCGAGTTGTGGAACAGCAATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207459.1-1529s1c1
Sequence:CCGGCCTCAGAGGGAAGCATTACAACTCGAGTTGTAATGCTTCCCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-383s1c1
Sequence:CCGGCAGCTTCAACATGGAGATCAGCTCGAGCTGATCTCCATGTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207459.1-385s1c1
Sequence:CCGGGCTTCAACATGGAGATCAGCTCTCGAGAGCTGATCTCCATGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207459.1-1560s1c1
Sequence:CCGGCCTGGAAACAAGTTCTTACCACTCGAGTGGTAAGAACTTGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-403s1c1
Sequence:CCGGGCTAAGCATTTGCTTCACCTGCTCGAGCAGGTGAAGCAAATGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-392s1c1
Sequence:CCGGCATGGAGATCAGCTAAGCATTCTCGAGAATGCTTAGCTGATCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207459.1-396s1c1
Sequence:CCGGGAGATCAGCTAAGCATTTGCTCTCGAGAGCAAATGCTTAGCTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144815    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207459.1-1584s1c1
Sequence:CCGGGATTGTCACATAGTTCTGGATCTCGAGATCCAGAACTATGTGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207459
TEX19 MISSION shRNA shRNA Plasmid DNA
testis expressed 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-756s1c1
Sequence:CCGGGATTTGAGGAGCTTCTTACCTCTCGAGAGGTAAGAAGCTCCTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207459.1-1436s1c1
Sequence:CCGGCCAGCAATTGCTGTTCCACAACTCGAGTTGTGGAACAGCAATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207459.1-1529s1c1
Sequence:CCGGCCTCAGAGGGAAGCATTACAACTCGAGTTGTAATGCTTCCCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-383s1c1
Sequence:CCGGCAGCTTCAACATGGAGATCAGCTCGAGCTGATCTCCATGTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207459.1-385s1c1
Sequence:CCGGGCTTCAACATGGAGATCAGCTCTCGAGAGCTGATCTCCATGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207459.1-1560s1c1
Sequence:CCGGCCTGGAAACAAGTTCTTACCACTCGAGTGGTAAGAACTTGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-403s1c1
Sequence:CCGGGCTAAGCATTTGCTTCACCTGCTCGAGCAGGTGAAGCAAATGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-392s1c1
Sequence:CCGGCATGGAGATCAGCTAAGCATTCTCGAGAATGCTTAGCTGATCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207459.1-396s1c1
Sequence:CCGGGAGATCAGCTAAGCATTTGCTCTCGAGAGCAAATGCTTAGCTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144815    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207459.1-1584s1c1
Sequence:CCGGGATTGTCACATAGTTCTGGATCTCGAGATCCAGAACTATGTGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207459
TEX19 MISSION shRNA Lentiviral Transduction Particles
testis expressed 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-756s1c1
Sequence:CCGGGATTTGAGGAGCTTCTTACCTCTCGAGAGGTAAGAAGCTCCTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207459.1-1436s1c1
Sequence:CCGGCCAGCAATTGCTGTTCCACAACTCGAGTTGTGGAACAGCAATTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207459.1-1529s1c1
Sequence:CCGGCCTCAGAGGGAAGCATTACAACTCGAGTTGTAATGCTTCCCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-383s1c1
Sequence:CCGGCAGCTTCAACATGGAGATCAGCTCGAGCTGATCTCCATGTTGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207459.1-385s1c1
Sequence:CCGGGCTTCAACATGGAGATCAGCTCTCGAGAGCTGATCTCCATGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141180    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207459.1-1560s1c1
Sequence:CCGGCCTGGAAACAAGTTCTTACCACTCGAGTGGTAAGAACTTGTTTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-403s1c1
Sequence:CCGGGCTAAGCATTTGCTTCACCTGCTCGAGCAGGTGAAGCAAATGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207459.1-392s1c1
Sequence:CCGGCATGGAGATCAGCTAAGCATTCTCGAGAATGCTTAGCTGATCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207459.1-396s1c1
Sequence:CCGGGAGATCAGCTAAGCATTTGCTCTCGAGAGCAAATGCTTAGCTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144815    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207459.1-1584s1c1
Sequence:CCGGGATTGTCACATAGTTCTGGATCTCGAGATCCAGAACTATGTGACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks