EMAIL THIS PAGE TO A FRIEND

TEX22

testis expressed 22

UniProtKB ID: C9J3V5
Gene ID:
Mouse(75671) testis expressed gene 22
domestic guinea pig(100731523) testis expressed 22
cow(100299645) testis expressed 22
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_930381 Rosetta Predictions human pricing
NM_029381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00286397 predicted 261
2 SASI_Hs01_00286398 predicted 263
3 SASI_Hs01_00286399 predicted 197
4 SASI_Hs02_00481293 predicted 211
5 SASI_Hs01_00286402 predicted 227
6 SASI_Hs01_00286403 predicted 472
7 SASI_Hs01_00286404 predicted 480
8 SASI_Hs01_00286406 predicted 431
9 SASI_Hs02_00481294 predicted 479
10 SASI_Hs02_00481295 predicted 476
11 SASI_Hs01_00286400 predicted 206
12 SASI_Hs01_00286401 predicted 204
13 SASI_Hs01_00286405 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026385 predicted 719
2 SASI_Mm01_00026387 predicted 844
3 SASI_Mm01_00026388 predicted 709
4 SASI_Mm01_00026389 predicted 903
5 SASI_Mm01_00026390 predicted 863
6 SASI_Mm01_00026391 predicted 860
7 SASI_Mm01_00026392 predicted 787
8 SASI_Mm01_00026393 predicted 854
9 SASI_Mm01_00026394 predicted 907
10 SASI_Mm02_00335254 predicted 1031
11 SASI_Mm01_00026386 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029381
TEX22 MISSION shRNA Bacterial Glycerol Stock
testis expressed 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-722s1c1
Sequence:CCGGCAGCTTGCTCAAGAGCAAAGACTCGAGTCTTTGCTCTTGAGCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-724s1c1
Sequence:CCGGGCTTGCTCAAGAGCAAAGACACTCGAGTGTCTTTGCTCTTGAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-731s1c1
Sequence:CCGGCAAGAGCAAAGACAACAGTCACTCGAGTGACTGTTGTCTTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-1100s1c1
Sequence:CCGGGAGGGTGTAGAGAGAGATGTACTCGAGTACATCTCTCTCTACACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-1111s1c1
Sequence:CCGGGAGAGATGTACTCATTTCTCACTCGAGTGAGAAATGAGTACATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029381
TEX22 MISSION shRNA shRNA Plasmid DNA
testis expressed 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-722s1c1
Sequence:CCGGCAGCTTGCTCAAGAGCAAAGACTCGAGTCTTTGCTCTTGAGCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-724s1c1
Sequence:CCGGGCTTGCTCAAGAGCAAAGACACTCGAGTGTCTTTGCTCTTGAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-731s1c1
Sequence:CCGGCAAGAGCAAAGACAACAGTCACTCGAGTGACTGTTGTCTTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-1100s1c1
Sequence:CCGGGAGGGTGTAGAGAGAGATGTACTCGAGTACATCTCTCTCTACACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-1111s1c1
Sequence:CCGGGAGAGATGTACTCATTTCTCACTCGAGTGAGAAATGAGTACATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029381
TEX22 MISSION shRNA Lentiviral Transduction Particles
testis expressed 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-722s1c1
Sequence:CCGGCAGCTTGCTCAAGAGCAAAGACTCGAGTCTTTGCTCTTGAGCAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-724s1c1
Sequence:CCGGGCTTGCTCAAGAGCAAAGACACTCGAGTGTCTTTGCTCTTGAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-731s1c1
Sequence:CCGGCAAGAGCAAAGACAACAGTCACTCGAGTGACTGTTGTCTTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-1100s1c1
Sequence:CCGGGAGGGTGTAGAGAGAGATGTACTCGAGTACATCTCTCTCTACACCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029381.1-1111s1c1
Sequence:CCGGGAGAGATGTACTCATTTCTCACTCGAGTGAGAAATGAGTACATCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks