EMAIL THIS PAGE TO A FRIEND

TEX261

testis expressed 261

Synonyms: TEG-261
UniProtKB ID: Q6UWH6, A1A587, D6W5G9, Q8WUJ5
Gene ID:
Mouse(21766) testis expressed gene 261
Rat(297392) testis expressed 261
Zebrafish(554131) testis expressed 261
domestic cat(101098533) testis expressed 261
dog(481425) testis expressed 261
naked mole-rat(101720662) testis expressed 261
domestic guinea pig(100723724) testis expressed 261
cow(514869) testis expressed 261
sheep(101108207) testis expressed 261
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303357 ANTI-TEX261 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
HPA016631 Anti-TEX261 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144582 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144582 Rosetta Predictions human pricing
NM_001017537 Rosetta Predictions rat pricing
NM_009357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228294 predicted 418
2 SASI_Hs02_00364367 predicted 1189
3 SASI_Hs01_00228295 predicted 1165
4 SASI_Hs01_00228296 predicted 673
5 SASI_Hs01_00228297 predicted 892
6 SASI_Hs01_00228298 predicted 273
7 SASI_Hs01_00228299 predicted 1194
8 SASI_Hs01_00228301 predicted 509
9 SASI_Hs01_00228302 predicted 330
10 SASI_Hs01_00228303 predicted 507
11 SASI_Hs01_00228300 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037839 predicted 314
2 SASI_Rn01_00037840 predicted 795
3 SASI_Rn01_00037841 predicted 523
4 SASI_Rn01_00037842 predicted 398
5 SASI_Rn01_00037844 predicted 483
6 SASI_Rn01_00037845 predicted 536
7 SASI_Rn02_00202355 predicted 592
8 SASI_Rn01_00037846 predicted 220
9 SASI_Rn01_00037847 predicted 333
10 SASI_Rn02_00202356 predicted 576
11 SASI_Rn01_00037838 predicted 429
12 SASI_Rn01_00037843 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121841 predicted 443
2 SASI_Mm01_00121842 predicted 538
3 SASI_Mm01_00121843 predicted 419
4 SASI_Mm01_00121844 predicted 501
5 SASI_Mm01_00121845 predicted 335
6 SASI_Mm01_00121846 predicted 551
7 SASI_Mm01_00121847 predicted 233
8 SASI_Mm01_00121848 predicted 586
9 SASI_Mm01_00121849 predicted 204
10 SASI_Mm02_00315957 predicted 431
11 SASI_Mm01_00121850 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144582
TEX261 MISSION shRNA Bacterial Glycerol Stock
testis expressed 261
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-507s1c1
Sequence:CCGGCTGCCTGTGGATAATTCCGTTCTCGAGAACGGAATTATCCACAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-657s1c1
Sequence:CCGGCTCCTTCATCAAAGAGGCCATCTCGAGATGGCCTCTTTGATGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-397s1c1
Sequence:CCGGCCTAACTTCATCCTGTCGTGTCTCGAGACACGACAGGATGAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144582.2-2306s1c1
Sequence:CCGGGCAGCATTTGACATGGCTGATCTCGAGATCAGCCATGTCAAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-587s1c1
Sequence:CCGGGAGATGATGTCGTCTCCAATTCTCGAGAATTGGAGACGACATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144582.2-424s1c1
Sequence:CCGGGTGGTGGTGAATCATTACCTACTCGAGTAGGTAATGATTCACCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144582.2-597s1c1
Sequence:CCGGCGTCTCCAATTATTTCACCAACTCGAGTTGGTGAAATAATTGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-494s1c1
Sequence:CCGGCCTATTTCACTTTCTGCCTGTCTCGAGACAGGCAGAAAGTGAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144582.2-513s1c1
Sequence:CCGGGTGGATAATTCCGTTTGCGTTCTCGAGAACGCAAACGGAATTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144582.2-1977s1c1
Sequence:CCGGGCCCTTCATTTCCTTGGCTTTCTCGAGAAAGCCAAGGAAATGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144582
TEX261 MISSION shRNA shRNA Plasmid DNA
testis expressed 261
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-507s1c1
Sequence:CCGGCTGCCTGTGGATAATTCCGTTCTCGAGAACGGAATTATCCACAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-657s1c1
Sequence:CCGGCTCCTTCATCAAAGAGGCCATCTCGAGATGGCCTCTTTGATGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-397s1c1
Sequence:CCGGCCTAACTTCATCCTGTCGTGTCTCGAGACACGACAGGATGAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144582.2-2306s1c1
Sequence:CCGGGCAGCATTTGACATGGCTGATCTCGAGATCAGCCATGTCAAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-587s1c1
Sequence:CCGGGAGATGATGTCGTCTCCAATTCTCGAGAATTGGAGACGACATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144582.2-424s1c1
Sequence:CCGGGTGGTGGTGAATCATTACCTACTCGAGTAGGTAATGATTCACCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144582.2-597s1c1
Sequence:CCGGCGTCTCCAATTATTTCACCAACTCGAGTTGGTGAAATAATTGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-494s1c1
Sequence:CCGGCCTATTTCACTTTCTGCCTGTCTCGAGACAGGCAGAAAGTGAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144582.2-513s1c1
Sequence:CCGGGTGGATAATTCCGTTTGCGTTCTCGAGAACGCAAACGGAATTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144582.2-1977s1c1
Sequence:CCGGGCCCTTCATTTCCTTGGCTTTCTCGAGAAAGCCAAGGAAATGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144582
TEX261 MISSION shRNA Lentiviral Transduction Particles
testis expressed 261
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-507s1c1
Sequence:CCGGCTGCCTGTGGATAATTCCGTTCTCGAGAACGGAATTATCCACAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-657s1c1
Sequence:CCGGCTCCTTCATCAAAGAGGCCATCTCGAGATGGCCTCTTTGATGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138348    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-397s1c1
Sequence:CCGGCCTAACTTCATCCTGTCGTGTCTCGAGACACGACAGGATGAAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144582.2-2306s1c1
Sequence:CCGGGCAGCATTTGACATGGCTGATCTCGAGATCAGCCATGTCAAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-587s1c1
Sequence:CCGGGAGATGATGTCGTCTCCAATTCTCGAGAATTGGAGACGACATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144582.2-424s1c1
Sequence:CCGGGTGGTGGTGAATCATTACCTACTCGAGTAGGTAATGATTCACCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144582.2-597s1c1
Sequence:CCGGCGTCTCCAATTATTTCACCAACTCGAGTTGGTGAAATAATTGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144582.2-494s1c1
Sequence:CCGGCCTATTTCACTTTCTGCCTGTCTCGAGACAGGCAGAAAGTGAAATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144582.2-513s1c1
Sequence:CCGGGTGGATAATTCCGTTTGCGTTCTCGAGAACGCAAACGGAATTATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144582.2-1977s1c1
Sequence:CCGGGCCCTTCATTTCCTTGGCTTTCTCGAGAAAGCCAAGGAAATGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009357
VALIDATED
TEX261 MISSION shRNA Bacterial Glycerol Stock
testis expressed 261
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-351s1c1
Sequence:CCGGGTGAATCATTACCTGGCATTTCTCGAGAAATGCCAGGTAATGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-209s1c1
Sequence:CCGGCCTCTACGTCTTTGAGCGTTTCTCGAGAAACGCTCAAAGACGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-158s1c1
Sequence:CCGGCAGCCGAATCATCAAATACATCTCGAGATGTATTTGATGATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-161s1c1
Sequence:CCGGCCGAATCATCAAATACATGATCTCGAGATCATGTATTTGATGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009357.1-1095s1c1
Sequence:CCGGGCTAACCTTCTGCCTAGACTACTCGAGTAGTCTAGGCAGAAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009357.2-405s21c1
Sequence:CCGGGTGAATCATTACCTGGCATTTCTCGAGAAATGCCAGGTAATGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009357.2-657s21c1
Sequence:CCGGCCCAGTCGGCAGAAGATATACCTCGAGGTATATCTTCTGCCGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009357.2-215s21c1
Sequence:CCGGCCGAATCATCAAATACATGATCTCGAGATCATGTATTTGATGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009357.2-1070s21c1
Sequence:CCGGGCTGATTCCCTTTCGAATAAACTCGAGTTTATTCGAAAGGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009357.2-263s21c1
Sequence:CCGGCCTCTACGTCTTTGAGCGTTTCTCGAGAAACGCTCAAAGACGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009357
VALIDATED
TEX261 MISSION shRNA shRNA Plasmid DNA
testis expressed 261
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-351s1c1
Sequence:CCGGGTGAATCATTACCTGGCATTTCTCGAGAAATGCCAGGTAATGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-209s1c1
Sequence:CCGGCCTCTACGTCTTTGAGCGTTTCTCGAGAAACGCTCAAAGACGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-158s1c1
Sequence:CCGGCAGCCGAATCATCAAATACATCTCGAGATGTATTTGATGATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-161s1c1
Sequence:CCGGCCGAATCATCAAATACATGATCTCGAGATCATGTATTTGATGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009357.1-1095s1c1
Sequence:CCGGGCTAACCTTCTGCCTAGACTACTCGAGTAGTCTAGGCAGAAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009357.2-405s21c1
Sequence:CCGGGTGAATCATTACCTGGCATTTCTCGAGAAATGCCAGGTAATGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009357.2-657s21c1
Sequence:CCGGCCCAGTCGGCAGAAGATATACCTCGAGGTATATCTTCTGCCGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009357.2-215s21c1
Sequence:CCGGCCGAATCATCAAATACATGATCTCGAGATCATGTATTTGATGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009357.2-1070s21c1
Sequence:CCGGGCTGATTCCCTTTCGAATAAACTCGAGTTTATTCGAAAGGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009357.2-263s21c1
Sequence:CCGGCCTCTACGTCTTTGAGCGTTTCTCGAGAAACGCTCAAAGACGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009357
VALIDATED
TEX261 MISSION shRNA Lentiviral Transduction Particles
testis expressed 261
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-351s1c1
Sequence:CCGGGTGAATCATTACCTGGCATTTCTCGAGAAATGCCAGGTAATGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-209s1c1
Sequence:CCGGCCTCTACGTCTTTGAGCGTTTCTCGAGAAACGCTCAAAGACGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-158s1c1
Sequence:CCGGCAGCCGAATCATCAAATACATCTCGAGATGTATTTGATGATTCGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009357.1-161s1c1
Sequence:CCGGCCGAATCATCAAATACATGATCTCGAGATCATGTATTTGATGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126274    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009357.1-1095s1c1
Sequence:CCGGGCTAACCTTCTGCCTAGACTACTCGAGTAGTCTAGGCAGAAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009357.2-405s21c1
Sequence:CCGGGTGAATCATTACCTGGCATTTCTCGAGAAATGCCAGGTAATGATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009357.2-657s21c1
Sequence:CCGGCCCAGTCGGCAGAAGATATACCTCGAGGTATATCTTCTGCCGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009357.2-215s21c1
Sequence:CCGGCCGAATCATCAAATACATGATCTCGAGATCATGTATTTGATGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009357.2-1070s21c1
Sequence:CCGGGCTGATTCCCTTTCGAATAAACTCGAGTTTATTCGAAAGGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009357.2-263s21c1
Sequence:CCGGCCTCTACGTCTTTGAGCGTTTCTCGAGAAACGCTCAAAGACGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks