EMAIL THIS PAGE TO A FRIEND

TEX264

testis expressed 264

Synonyms: ZSIG11
UniProtKB ID: Q9Y6I9, B3KN87, Q9UKD7
Gene ID:
Mouse(21767) testis expressed gene 264
Rat(300988) testis expressed 264
cow(535455) testis expressed 264
sheep(101114144) testis expressed 264
domestic guinea pig(100734934) testis expressed 264
naked mole-rat(101722453) testis expressed 264
chicken(415938) testis expressed 264
domestic cat(101098206) testis expressed 264
dog(476607) testis expressed 264
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011573 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011573 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011573 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015926 Rosetta Predictions human pricing
NM_001007665 Rosetta Predictions rat pricing
NM_001081654 Rosetta Predictions mouse pricing
NM_011573 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348547 predicted 1271
2 SASI_Hs01_00146076 predicted 663
3 SASI_Hs01_00146077 predicted 442
4 SASI_Hs01_00146078 predicted 957
5 SASI_Hs01_00146079 predicted 528
6 SASI_Hs02_00348548 predicted 864
7 SASI_Hs01_00146082 predicted 1066
8 SASI_Hs01_00146084 predicted 364
9 SASI_Hs01_00146085 predicted 826
10 SASI_Hs02_00348549 predicted 954
11 SASI_Hs01_00146080 predicted 978
12 SASI_Hs01_00146081 predicted 973
13 SASI_Hs01_00146083 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044728 predicted 342
2 SASI_Rn01_00044729 predicted 1102
3 SASI_Rn01_00044730 predicted 413
4 SASI_Rn02_00198792 predicted 707
5 SASI_Rn01_00044731 predicted 375
6 SASI_Rn01_00044732 predicted 705
7 SASI_Rn01_00044733 predicted 1001
8 SASI_Rn01_00044734 predicted 1211
9 SASI_Rn01_00044735 predicted 639
10 SASI_Rn01_00044736 predicted 835
11 SASI_Rn01_00044737 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298823 predicted 979
2 SASI_Mm02_00298824 predicted 886
3 SASI_Mm02_00298825 predicted 557
4 SASI_Mm02_00298826 predicted 340
5 SASI_Mm02_00298827 predicted 466
6 SASI_Mm02_00298828 predicted 573
7 SASI_Mm02_00298829 predicted 778
8 SASI_Mm02_00298830 predicted 1188
9 SASI_Mm02_00298831 predicted 311
10 SASI_Mm02_00298832 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011573 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191262 predicted 1282
2 SASI_Mm01_00191263 predicted 1195
3 SASI_Mm02_00320955 predicted 873
4 SASI_Mm02_00320956 predicted 659
5 SASI_Mm02_00320957 predicted 776
6 SASI_Mm02_00320958 predicted 877
7 SASI_Mm01_00191265 predicted 1082
8 SASI_Mm01_00191266 predicted 1501
9 SASI_Mm02_00320959 predicted 622
10 SASI_Mm01_00191267 predicted 1309
11 SASI_Mm01_00191264 predicted 1392
12 SASI_Mm01_00191268 predicted 1386
13 SASI_Mm01_00191269 predicted 1051
14 SASI_Mm01_00191270 predicted 1046
15 SASI_Mm01_00191271 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015926
TEX264 MISSION shRNA Bacterial Glycerol Stock
testis expressed 264
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015926.4-702s21c1
Sequence:CCGGGAAGGAGACAGAGTGGAAATGCTCGAGCATTTCCACTCTGTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015926.4-343s21c1
Sequence:CCGGTCCATCGCTGTCTACTATGACCTCGAGGTCATAGTAGACAGCGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015926.4-251s21c1
Sequence:CCGGACGTCACTGTGGCCTACAAGTCTCGAGACTTGTAGGCCACAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-827s1c1
Sequence:CCGGCCAGGAAGACCAGATCCATTTCTCGAGAAATGGATCTGGTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-641s1c1
Sequence:CCGGCATCGACCTCTACCAGAAATTCTCGAGAATTTCTGGTAGAGGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-650s1c1
Sequence:CCGGCTACCAGAAATTTGGCTTCAACTCGAGTTGAAGCCAAATTTCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-535s1c1
Sequence:CCGGCCATCGCTGTCTACTATGACACTCGAGTGTCATAGTAGACAGCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-837s1c1
Sequence:CCGGCAGATCCATTTCATGTGCCCACTCGAGTGGGCACATGAAATGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-973s1c1
Sequence:CCGGGTGACACGAGTTCTGTAAGCTCTCGAGAGCTTACAGAACTCGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-871s1c1
Sequence:CCGGGAGACTTCTATGTGCCTGAGACTCGAGTCTCAGGCACATAGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015926
TEX264 MISSION shRNA shRNA Plasmid DNA
testis expressed 264
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015926.4-702s21c1
Sequence:CCGGGAAGGAGACAGAGTGGAAATGCTCGAGCATTTCCACTCTGTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015926.4-343s21c1
Sequence:CCGGTCCATCGCTGTCTACTATGACCTCGAGGTCATAGTAGACAGCGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015926.4-251s21c1
Sequence:CCGGACGTCACTGTGGCCTACAAGTCTCGAGACTTGTAGGCCACAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-827s1c1
Sequence:CCGGCCAGGAAGACCAGATCCATTTCTCGAGAAATGGATCTGGTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-641s1c1
Sequence:CCGGCATCGACCTCTACCAGAAATTCTCGAGAATTTCTGGTAGAGGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-650s1c1
Sequence:CCGGCTACCAGAAATTTGGCTTCAACTCGAGTTGAAGCCAAATTTCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-535s1c1
Sequence:CCGGCCATCGCTGTCTACTATGACACTCGAGTGTCATAGTAGACAGCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-837s1c1
Sequence:CCGGCAGATCCATTTCATGTGCCCACTCGAGTGGGCACATGAAATGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-973s1c1
Sequence:CCGGGTGACACGAGTTCTGTAAGCTCTCGAGAGCTTACAGAACTCGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-871s1c1
Sequence:CCGGGAGACTTCTATGTGCCTGAGACTCGAGTCTCAGGCACATAGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015926
TEX264 MISSION shRNA Lentiviral Transduction Particles
testis expressed 264
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015926.4-702s21c1
Sequence:CCGGGAAGGAGACAGAGTGGAAATGCTCGAGCATTTCCACTCTGTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015926.4-343s21c1
Sequence:CCGGTCCATCGCTGTCTACTATGACCTCGAGGTCATAGTAGACAGCGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015926.4-251s21c1
Sequence:CCGGACGTCACTGTGGCCTACAAGTCTCGAGACTTGTAGGCCACAGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-827s1c1
Sequence:CCGGCCAGGAAGACCAGATCCATTTCTCGAGAAATGGATCTGGTCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-641s1c1
Sequence:CCGGCATCGACCTCTACCAGAAATTCTCGAGAATTTCTGGTAGAGGTCGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-650s1c1
Sequence:CCGGCTACCAGAAATTTGGCTTCAACTCGAGTTGAAGCCAAATTTCTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-535s1c1
Sequence:CCGGCCATCGCTGTCTACTATGACACTCGAGTGTCATAGTAGACAGCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-837s1c1
Sequence:CCGGCAGATCCATTTCATGTGCCCACTCGAGTGGGCACATGAAATGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165601    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-973s1c1
Sequence:CCGGGTGACACGAGTTCTGTAAGCTCTCGAGAGCTTACAGAACTCGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015926.3-871s1c1
Sequence:CCGGGAGACTTCTATGTGCCTGAGACTCGAGTCTCAGGCACATAGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011573
TEX264 MISSION shRNA Bacterial Glycerol Stock
testis expressed 264
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011573.2-1572s21c1
Sequence:CCGGTGTCCTGCTCCAAGCCTAAACCTCGAGGTTTAGGCTTGGAGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-1048s21c1
Sequence:CCGGCCATCAAGACAAGATCCATTTCTCGAGAAATGGATCTTGTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-1113s21c1
Sequence:CCGGTGAAGGAGACAGAGCGGAAATCTCGAGATTTCCGCTCTGTCTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-591s21c1
Sequence:CCGGTGCTGGCCTTTGCTGGTTATTCTCGAGAATAACCAGCAAAGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-909s21c1
Sequence:CCGGCACCTAGCCATGTGGTCATAGCTCGAGCTATGACCACATGGCTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011573.1-1036s1c1
Sequence:CCGGCCTGGAGATCTACCATCAAGACTCGAGTCTTGATGGTAGATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011573.1-859s1c1
Sequence:CCGGGCTCATCCACCTCTATCAGAACTCGAGTTCTGATAGAGGTGGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011573.1-1525s1c1
Sequence:CCGGCTTCCTTAACCTGCCTAGCTTCTCGAGAAGCTAGGCAGGTTAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011573
TEX264 MISSION shRNA shRNA Plasmid DNA
testis expressed 264
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011573.2-1572s21c1
Sequence:CCGGTGTCCTGCTCCAAGCCTAAACCTCGAGGTTTAGGCTTGGAGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-1048s21c1
Sequence:CCGGCCATCAAGACAAGATCCATTTCTCGAGAAATGGATCTTGTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-1113s21c1
Sequence:CCGGTGAAGGAGACAGAGCGGAAATCTCGAGATTTCCGCTCTGTCTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-591s21c1
Sequence:CCGGTGCTGGCCTTTGCTGGTTATTCTCGAGAATAACCAGCAAAGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-909s21c1
Sequence:CCGGCACCTAGCCATGTGGTCATAGCTCGAGCTATGACCACATGGCTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011573.1-1036s1c1
Sequence:CCGGCCTGGAGATCTACCATCAAGACTCGAGTCTTGATGGTAGATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011573.1-859s1c1
Sequence:CCGGGCTCATCCACCTCTATCAGAACTCGAGTTCTGATAGAGGTGGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011573.1-1525s1c1
Sequence:CCGGCTTCCTTAACCTGCCTAGCTTCTCGAGAAGCTAGGCAGGTTAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011573
TEX264 MISSION shRNA Lentiviral Transduction Particles
testis expressed 264
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011573.2-1572s21c1
Sequence:CCGGTGTCCTGCTCCAAGCCTAAACCTCGAGGTTTAGGCTTGGAGCAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-1048s21c1
Sequence:CCGGCCATCAAGACAAGATCCATTTCTCGAGAAATGGATCTTGTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-1113s21c1
Sequence:CCGGTGAAGGAGACAGAGCGGAAATCTCGAGATTTCCGCTCTGTCTCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-591s21c1
Sequence:CCGGTGCTGGCCTTTGCTGGTTATTCTCGAGAATAACCAGCAAAGGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011573.2-909s21c1
Sequence:CCGGCACCTAGCCATGTGGTCATAGCTCGAGCTATGACCACATGGCTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011573.1-1036s1c1
Sequence:CCGGCCTGGAGATCTACCATCAAGACTCGAGTCTTGATGGTAGATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011573.1-859s1c1
Sequence:CCGGGCTCATCCACCTCTATCAGAACTCGAGTTCTGATAGAGGTGGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011573.1-1525s1c1
Sequence:CCGGCTTCCTTAACCTGCCTAGCTTCTCGAGAAGCTAGGCAGGTTAAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks