EMAIL THIS PAGE TO A FRIEND

TEX26

testis expressed 26

Synonyms: C13orf26
UniProtKB ID: Q8N6G2
Gene ID:
Mouse(75860) testis expressed 26
Rat(498133) testis expressed 26
cow(508945) testis expressed 26
sheep(101111031) testis expressed 26
domestic guinea pig(100734290) testis expressed 26
naked mole-rat(101703163) testis expressed 26
domestic cat(101100532) testis expressed 26
dog(607957) testis expressed 26
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152325 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152325 Rosetta Predictions human pricing
NM_001134603 Rosetta Predictions rat pricing
XM_573344 Rosetta Predictions rat pricing
XM_132524 Rosetta Predictions mouse pricing
XM_905635 Rosetta Predictions mouse pricing
XM_994019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135530 predicted 263
2 SASI_Hs01_00135531 predicted 422
3 SASI_Hs01_00135532 predicted 347
4 SASI_Hs01_00135533 predicted 200
5 SASI_Hs01_00135535 predicted 213
6 SASI_Hs01_00135536 predicted 202
7 SASI_Hs01_00135537 predicted 224
8 SASI_Hs01_00135538 predicted 253
9 SASI_Hs01_00135539 predicted 458
10 SASI_Hs02_00365920 predicted 425
11 SASI_Hs01_00135534 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134603 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257509 predicted 768
2 SASI_Rn02_00257510 predicted 277
3 SASI_Rn02_00257511 predicted 782
4 SASI_Rn02_00257512 predicted 431
5 SASI_Rn02_00257513 predicted 636
6 SASI_Rn02_00257514 predicted 312
7 SASI_Rn02_00257515 predicted 768
8 SASI_Rn02_00257516 predicted 246
9 SASI_Rn02_00257517 predicted 414
10 SASI_Rn02_00257518 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00132640 predicted 285
2 SASI_Rn01_00132641 predicted 344
3 SASI_Rn01_00132642 predicted 272
4 SASI_Rn01_00132643 predicted 445
5 SASI_Rn01_00132644 predicted 242
6 SASI_Rn01_00132645 predicted 263
7 SASI_Rn01_00132646 predicted 222
8 SASI_Rn01_00132647 predicted 212
9 SASI_Rn01_00132648 predicted 376
10 SASI_Rn01_00132649 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424464 predicted 234
2 SASI_Mm02_00424465 predicted 202
3 SASI_Mm02_00424466 predicted 256
4 SASI_Mm02_00424467 predicted 323
5 SASI_Mm02_00424468 predicted 848
6 SASI_Mm02_00424469 predicted 244
7 SASI_Mm02_00424470 predicted 301
8 SASI_Mm01_00244445 predicted 297
9 SASI_Mm02_00424471 predicted 832
10 SASI_Mm02_00424472 predicted 823
11 SASI_Mm01_00244439 predicted 606
12 SASI_Mm01_00244440 predicted 460
13 SASI_Mm01_00244441 predicted 978
14 SASI_Mm01_00244442 predicted 980
15 SASI_Mm01_00244443 predicted 190
16 SASI_Mm01_00244444 predicted 598
17 SASI_Mm01_00244446 predicted 162
18 SASI_Mm01_00244447 predicted 187
19 SASI_Mm01_00244448 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431920 predicted 600
2 SASI_Mm02_00431921 predicted 230
3 SASI_Mm02_00431922 predicted 326
4 SASI_Mm02_00431923 predicted 460
5 SASI_Mm02_00431924 predicted 786
6 SASI_Mm02_00431925 predicted 742
7 SASI_Mm02_00431926 predicted 297
8 SASI_Mm02_00431927 predicted 585
9 SASI_Mm02_00431928 predicted 297
10 SASI_Mm02_00431929 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_994019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221700 predicted 964
2 SASI_Mm01_00221701 predicted 995
3 SASI_Mm01_00221702 predicted 587
4 SASI_Mm01_00221703 predicted 808
5 SASI_Mm01_00221704 predicted 450
6 SASI_Mm01_00221705 predicted 568
7 SASI_Mm01_00221706 predicted 968
8 SASI_Mm01_00221707 predicted 589
9 SASI_Mm01_00221708 predicted 286
10 SASI_Mm01_00221709 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029464
TEX26 MISSION shRNA Bacterial Glycerol Stock
testis expressed 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-807s21c1
Sequence:CCGGTTCCTACAAAGACCGACAAATCTCGAGATTTGTCGGTCTTTGTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-143s21c1
Sequence:CCGGGAGGGATGGTGCCCGATTTAACTCGAGTTAAATCGGGCACCATCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-543s21c1
Sequence:CCGGGGACACTGAATTTCGATATAACTCGAGTTATATCGAAATTCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029464.1-923s21c1
Sequence:CCGGCAGATGGAGCTCTGGTTGTTTCTCGAGAAACAACCAGAGCTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-858s21c1
Sequence:CCGGCATTGAGGCAAAGCCTAATAACTCGAGTTATTAGGCTTTGCCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029464
TEX26 MISSION shRNA shRNA Plasmid DNA
testis expressed 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-807s21c1
Sequence:CCGGTTCCTACAAAGACCGACAAATCTCGAGATTTGTCGGTCTTTGTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-143s21c1
Sequence:CCGGGAGGGATGGTGCCCGATTTAACTCGAGTTAAATCGGGCACCATCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-543s21c1
Sequence:CCGGGGACACTGAATTTCGATATAACTCGAGTTATATCGAAATTCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029464.1-923s21c1
Sequence:CCGGCAGATGGAGCTCTGGTTGTTTCTCGAGAAACAACCAGAGCTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-858s21c1
Sequence:CCGGCATTGAGGCAAAGCCTAATAACTCGAGTTATTAGGCTTTGCCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029464
TEX26 MISSION shRNA Lentiviral Transduction Particles
testis expressed 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-807s21c1
Sequence:CCGGTTCCTACAAAGACCGACAAATCTCGAGATTTGTCGGTCTTTGTAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-143s21c1
Sequence:CCGGGAGGGATGGTGCCCGATTTAACTCGAGTTAAATCGGGCACCATCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-543s21c1
Sequence:CCGGGGACACTGAATTTCGATATAACTCGAGTTATATCGAAATTCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029464.1-923s21c1
Sequence:CCGGCAGATGGAGCTCTGGTTGTTTCTCGAGAAACAACCAGAGCTCCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029464.1-858s21c1
Sequence:CCGGCATTGAGGCAAAGCCTAATAACTCGAGTTATTAGGCTTTGCCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152325
TEX26 MISSION shRNA Bacterial Glycerol Stock
testis expressed 26
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152325.1-938s21c1
Sequence:CCGGCGAGGACATTCCTAGTCATTTCTCGAGAAATGACTAGGAATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-119s21c1
Sequence:CCGGAGGACTGCATTCACGCCTAAACTCGAGTTTAGGCGTGAATGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-563s21c1
Sequence:CCGGTTCCGAAGGAATTACCAAATTCTCGAGAATTTGGTAATTCCTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-431s21c1
Sequence:CCGGGCACTATCAAATCAGTTTATTCTCGAGAATAAACTGATTTGATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-175s21c1
Sequence:CCGGTATCAGAAGATTAGGATATACCTCGAGGTATATCCTAATCTTCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152325.1-596s1c1
Sequence:CCGGCCTGAGCTTCAAGATTTCAGTCTCGAGACTGAAATCTTGAAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152325.1-597s1c1
Sequence:CCGGCTGAGCTTCAAGATTTCAGTTCTCGAGAACTGAAATCTTGAAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152325.1-613s1c1
Sequence:CCGGCAGTTTCAAATATGGATGCTACTCGAGTAGCATCCATATTTGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152325
TEX26 MISSION shRNA shRNA Plasmid DNA
testis expressed 26
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152325.1-938s21c1
Sequence:CCGGCGAGGACATTCCTAGTCATTTCTCGAGAAATGACTAGGAATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-119s21c1
Sequence:CCGGAGGACTGCATTCACGCCTAAACTCGAGTTTAGGCGTGAATGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-563s21c1
Sequence:CCGGTTCCGAAGGAATTACCAAATTCTCGAGAATTTGGTAATTCCTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-431s21c1
Sequence:CCGGGCACTATCAAATCAGTTTATTCTCGAGAATAAACTGATTTGATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-175s21c1
Sequence:CCGGTATCAGAAGATTAGGATATACCTCGAGGTATATCCTAATCTTCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152325.1-596s1c1
Sequence:CCGGCCTGAGCTTCAAGATTTCAGTCTCGAGACTGAAATCTTGAAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152325.1-597s1c1
Sequence:CCGGCTGAGCTTCAAGATTTCAGTTCTCGAGAACTGAAATCTTGAAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152325.1-613s1c1
Sequence:CCGGCAGTTTCAAATATGGATGCTACTCGAGTAGCATCCATATTTGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152325
TEX26 MISSION shRNA Lentiviral Transduction Particles
testis expressed 26
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152325.1-938s21c1
Sequence:CCGGCGAGGACATTCCTAGTCATTTCTCGAGAAATGACTAGGAATGTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-119s21c1
Sequence:CCGGAGGACTGCATTCACGCCTAAACTCGAGTTTAGGCGTGAATGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-563s21c1
Sequence:CCGGTTCCGAAGGAATTACCAAATTCTCGAGAATTTGGTAATTCCTTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-431s21c1
Sequence:CCGGGCACTATCAAATCAGTTTATTCTCGAGAATAAACTGATTTGATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152325.1-175s21c1
Sequence:CCGGTATCAGAAGATTAGGATATACCTCGAGGTATATCCTAATCTTCTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152325.1-596s1c1
Sequence:CCGGCCTGAGCTTCAAGATTTCAGTCTCGAGACTGAAATCTTGAAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152325.1-597s1c1
Sequence:CCGGCTGAGCTTCAAGATTTCAGTTCTCGAGAACTGAAATCTTGAAGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152325.1-613s1c1
Sequence:CCGGCAGTTTCAAATATGGATGCTACTCGAGTAGCATCCATATTTGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks