EMAIL THIS PAGE TO A FRIEND

TEX28

testis expressed 28

Synonyms: CXorf2 TEX28P1 TEX28P2 fTEX
UniProtKB ID: O15482, B1B1E8, D3DWW5
Gene ID:
Mouse(385380) testis expressed 28
Rat(690282) testis expressed 28
dog(492248) testis expressed 28
domestic cat(101091001) testis expressed 28
naked mole-rat(101715126) testis expressed 28
domestic guinea pig(100734590) testis expressed 28
cow(539819) testis expressed 28
sheep(101120899) testis expressed 28
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001126488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001126488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001126488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113901 MISSION® esiRNA esiRNA human TEX28 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001586 Rosetta Predictions human pricing
XM_001073954 Rosetta Predictions rat pricing
NM_001126488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034610 predicted 1025
2 SASI_Hs01_00034611 predicted 1115
3 SASI_Hs01_00034612 predicted 531
4 SASI_Hs02_00332151 predicted 710
5 SASI_Hs02_00332152 predicted 1013
6 SASI_Hs01_00034613 predicted 1154
7 SASI_Hs02_00332153 predicted 923
8 SASI_Hs01_00034615 predicted 1234
9 SASI_Hs01_00034617 predicted 997
10 SASI_Hs01_00034618 predicted 1208
11 SASI_Hs01_00034614 predicted 974
12 SASI_Hs01_00034616 predicted 413
13 SASI_Hs01_00034619 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344500 predicted 557
2 SASI_Rn02_00344501 predicted 629
3 SASI_Rn02_00344502 predicted 300
4 SASI_Rn02_00344503 predicted 848
5 SASI_Rn02_00344504 predicted 838
6 SASI_Rn02_00344505 predicted 865
7 SASI_Rn02_00344506 predicted 767
8 SASI_Rn02_00344507 predicted 740
9 SASI_Rn02_00344508 predicted 667
10 SASI_Rn02_00344509 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310071 predicted 191
2 SASI_Mm02_00310072 predicted 702
3 SASI_Mm02_00310073 predicted 353
4 SASI_Mm02_00310074 predicted 611
5 SASI_Mm02_00310075 predicted 767
6 SASI_Mm02_00310076 predicted 679
7 SASI_Mm02_00310077 predicted 894
8 SASI_Mm02_00310078 predicted 827
9 SASI_Mm02_00310079 predicted 301
10 SASI_Mm02_00310080 predicted 710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001586
TEX28 MISSION shRNA Bacterial Glycerol Stock
testis expressed 28
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-985s1c1
Sequence:CCGGGCCTATCTATCCTATGAGAGACTCGAGTCTCTCATAGGATAGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-536s1c1
Sequence:CCGGGCTTACTGCTGATGGCAGAAACTCGAGTTTCTGCCATCAGCAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-930s1c1
Sequence:CCGGGCTGAATGAGATTTACAACCTCTCGAGAGGTTGTAAATCTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-996s1c1
Sequence:CCGGCTATGAGAGAGCCAAGGAAATCTCGAGATTTCCTTGGCTCTCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001586.1-973s1c1
Sequence:CCGGGAAGAGAGAATGGCCTATCTACTCGAGTAGATAGGCCATTCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-676s21c1
Sequence:CCGGAGTCGCTTCCAGAGCTTACAGCTCGAGCTGTAAGCTCTGGAAGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-371s21c1
Sequence:CCGGACCTCAAGCTGGTATCCAAAGCTCGAGCTTTGGATACCAGCTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-1160s21c1
Sequence:CCGGCAACCGTCCTCTTGGTCTTTGCTCGAGCAAAGACCAAGAGGACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-1032s21c1
Sequence:CCGGGACCTTCAAGAGCCGAATATCCTCGAGGATATTCGGCTCTTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001586
TEX28 MISSION shRNA shRNA Plasmid DNA
testis expressed 28
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-985s1c1
Sequence:CCGGGCCTATCTATCCTATGAGAGACTCGAGTCTCTCATAGGATAGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-536s1c1
Sequence:CCGGGCTTACTGCTGATGGCAGAAACTCGAGTTTCTGCCATCAGCAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-930s1c1
Sequence:CCGGGCTGAATGAGATTTACAACCTCTCGAGAGGTTGTAAATCTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-996s1c1
Sequence:CCGGCTATGAGAGAGCCAAGGAAATCTCGAGATTTCCTTGGCTCTCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001586.1-973s1c1
Sequence:CCGGGAAGAGAGAATGGCCTATCTACTCGAGTAGATAGGCCATTCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-676s21c1
Sequence:CCGGAGTCGCTTCCAGAGCTTACAGCTCGAGCTGTAAGCTCTGGAAGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-371s21c1
Sequence:CCGGACCTCAAGCTGGTATCCAAAGCTCGAGCTTTGGATACCAGCTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-1160s21c1
Sequence:CCGGCAACCGTCCTCTTGGTCTTTGCTCGAGCAAAGACCAAGAGGACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-1032s21c1
Sequence:CCGGGACCTTCAAGAGCCGAATATCCTCGAGGATATTCGGCTCTTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001586
TEX28 MISSION shRNA Lentiviral Transduction Particles
testis expressed 28
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-985s1c1
Sequence:CCGGGCCTATCTATCCTATGAGAGACTCGAGTCTCTCATAGGATAGATAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-536s1c1
Sequence:CCGGGCTTACTGCTGATGGCAGAAACTCGAGTTTCTGCCATCAGCAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-930s1c1
Sequence:CCGGGCTGAATGAGATTTACAACCTCTCGAGAGGTTGTAAATCTCATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001586.1-996s1c1
Sequence:CCGGCTATGAGAGAGCCAAGGAAATCTCGAGATTTCCTTGGCTCTCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001586.1-973s1c1
Sequence:CCGGGAAGAGAGAATGGCCTATCTACTCGAGTAGATAGGCCATTCTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-676s21c1
Sequence:CCGGAGTCGCTTCCAGAGCTTACAGCTCGAGCTGTAAGCTCTGGAAGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-371s21c1
Sequence:CCGGACCTCAAGCTGGTATCCAAAGCTCGAGCTTTGGATACCAGCTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-1160s21c1
Sequence:CCGGCAACCGTCCTCTTGGTCTTTGCTCGAGCAAAGACCAAGAGGACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001586.1-1032s21c1
Sequence:CCGGGACCTTCAAGAGCCGAATATCCTCGAGGATATTCGGCTCTTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001126488
TEX28 MISSION shRNA Bacterial Glycerol Stock
testis expressed 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-559s21c1
Sequence:CCGGCTACTCTAGAGAGTCACTTATCTCGAGATAAGTGACTCTCTAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-1120s21c1
Sequence:CCGGTGCGCATCTTCATTGTATTTACTCGAGTAAATACAATGAAGATGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-878s21c1
Sequence:CCGGGGCCTATTTGTCCTATGAAAGCTCGAGCTTTCATAGGACAAATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-480s21c1
Sequence:CCGGCCAAGTGGGAAAGTTTCATATCTCGAGATATGAAACTTTCCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-1177s21c1
Sequence:CCGGGCCATGTCATCTCTATTATTGCTCGAGCAATAATAGAGATGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001126488
TEX28 MISSION shRNA shRNA Plasmid DNA
testis expressed 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-559s21c1
Sequence:CCGGCTACTCTAGAGAGTCACTTATCTCGAGATAAGTGACTCTCTAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-1120s21c1
Sequence:CCGGTGCGCATCTTCATTGTATTTACTCGAGTAAATACAATGAAGATGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-878s21c1
Sequence:CCGGGGCCTATTTGTCCTATGAAAGCTCGAGCTTTCATAGGACAAATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-480s21c1
Sequence:CCGGCCAAGTGGGAAAGTTTCATATCTCGAGATATGAAACTTTCCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-1177s21c1
Sequence:CCGGGCCATGTCATCTCTATTATTGCTCGAGCAATAATAGAGATGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001126488
TEX28 MISSION shRNA Lentiviral Transduction Particles
testis expressed 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-559s21c1
Sequence:CCGGCTACTCTAGAGAGTCACTTATCTCGAGATAAGTGACTCTCTAGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-1120s21c1
Sequence:CCGGTGCGCATCTTCATTGTATTTACTCGAGTAAATACAATGAAGATGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-878s21c1
Sequence:CCGGGGCCTATTTGTCCTATGAAAGCTCGAGCTTTCATAGGACAAATAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-480s21c1
Sequence:CCGGCCAAGTGGGAAAGTTTCATATCTCGAGATATGAAACTTTCCCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001126488.1-1177s21c1
Sequence:CCGGGCCATGTCATCTCTATTATTGCTCGAGCAATAATAGAGATGACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks