EMAIL THIS PAGE TO A FRIEND

TEX29

testis expressed 29

Synonyms: C13orf16 bA474D23.1
UniProtKB ID: Q8N6K0
Gene ID:
Mouse(75528) testis expressed 29
Rat(498664) testis expressed 29
dog(476988) testis expressed 29
cow(617473) testis expressed 29
sheep(101117090) testis expressed 29
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152324 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029326 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029326 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029326 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052771 MISSION® esiRNA esiRNA human C13orf16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152324 Rosetta Predictions human pricing
NM_001017508 Rosetta Predictions rat pricing
NM_029326 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089890 predicted 294
2 SASI_Hs01_00089891 predicted 307
3 SASI_Hs01_00089892 predicted 304
4 SASI_Hs01_00089894 predicted 363
5 SASI_Hs01_00089895 predicted 281
6 SASI_Hs01_00089896 predicted 299
7 SASI_Hs01_00089897 predicted 406
8 SASI_Hs01_00089898 predicted 313
9 SASI_Hs01_00089899 predicted 459
10 SASI_Hs02_00365919 predicted 278
11 SASI_Hs01_00089893 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092057 predicted 384
2 SASI_Rn01_00092058 predicted 1047
3 SASI_Rn01_00092059 predicted 1038
4 SASI_Rn02_00202337 predicted 272
5 SASI_Rn01_00092060 predicted 1239
6 SASI_Rn01_00092063 predicted 1194
7 SASI_Rn01_00092065 predicted 1250
8 SASI_Rn01_00092066 predicted 1164
9 SASI_Rn02_00202338 predicted 1163
10 SASI_Rn02_00202339 predicted 1199
11 SASI_Rn01_00092061 predicted 1068
12 SASI_Rn01_00092062 predicted 1007
13 SASI_Rn01_00092064 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044359 predicted 501
2 SASI_Mm01_00044360 predicted 419
3 SASI_Mm01_00044361 predicted 365
4 SASI_Mm01_00044362 predicted 329
5 SASI_Mm01_00044363 predicted 512
6 SASI_Mm01_00044364 predicted 385
7 SASI_Mm01_00044365 predicted 304
8 SASI_Mm01_00044366 predicted 270
9 SASI_Mm01_00044367 predicted 211
10 SASI_Mm01_00044368 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152324
TEX29 MISSION shRNA Bacterial Glycerol Stock
testis expressed 29
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152324.1-312s21c1
Sequence:CCGGGTTCTCTGCCTTGATTGTGATCTCGAGATCACAATCAAGGCAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152324.1-358s21c1
Sequence:CCGGATCATCTACAGAGTCATTCAGCTCGAGCTGAATGACTCTGTAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152324.1-410s21c1
Sequence:CCGGATGTCGCGCTGCCACAGAAGTCTCGAGACTTCTGTGGCAGCGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-279s1c1
Sequence:CCGGCTACAAGAAAGCGGTTCCCATCTCGAGATGGGAACCGCTTTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-554s1c1
Sequence:CCGGCAATAACAGAAGCCGAAGAAACTCGAGTTTCTTCGGCTTCTGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152324.1-193s1c1
Sequence:CCGGGATGTTCCTCTGTATGACATTCTCGAGAATGTCATACAGAGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-285s1c1
Sequence:CCGGGAAAGCGGTTCCCATTTACATCTCGAGATGTAAATGGGAACCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-516s1c1
Sequence:CCGGGATGAAGAGTGACGAGGATAACTCGAGTTATCCTCGTCACTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-177s1c1
Sequence:CCGGGCAATTCACAGTGTGTGATGTCTCGAGACATCACACACTGTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152324
TEX29 MISSION shRNA shRNA Plasmid DNA
testis expressed 29
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152324.1-312s21c1
Sequence:CCGGGTTCTCTGCCTTGATTGTGATCTCGAGATCACAATCAAGGCAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152324.1-358s21c1
Sequence:CCGGATCATCTACAGAGTCATTCAGCTCGAGCTGAATGACTCTGTAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152324.1-410s21c1
Sequence:CCGGATGTCGCGCTGCCACAGAAGTCTCGAGACTTCTGTGGCAGCGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-279s1c1
Sequence:CCGGCTACAAGAAAGCGGTTCCCATCTCGAGATGGGAACCGCTTTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-554s1c1
Sequence:CCGGCAATAACAGAAGCCGAAGAAACTCGAGTTTCTTCGGCTTCTGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152324.1-193s1c1
Sequence:CCGGGATGTTCCTCTGTATGACATTCTCGAGAATGTCATACAGAGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-285s1c1
Sequence:CCGGGAAAGCGGTTCCCATTTACATCTCGAGATGTAAATGGGAACCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-516s1c1
Sequence:CCGGGATGAAGAGTGACGAGGATAACTCGAGTTATCCTCGTCACTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-177s1c1
Sequence:CCGGGCAATTCACAGTGTGTGATGTCTCGAGACATCACACACTGTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152324
TEX29 MISSION shRNA Lentiviral Transduction Particles
testis expressed 29
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152324.1-312s21c1
Sequence:CCGGGTTCTCTGCCTTGATTGTGATCTCGAGATCACAATCAAGGCAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152324.1-358s21c1
Sequence:CCGGATCATCTACAGAGTCATTCAGCTCGAGCTGAATGACTCTGTAGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152324.1-410s21c1
Sequence:CCGGATGTCGCGCTGCCACAGAAGTCTCGAGACTTCTGTGGCAGCGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-279s1c1
Sequence:CCGGCTACAAGAAAGCGGTTCCCATCTCGAGATGGGAACCGCTTTCTTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-554s1c1
Sequence:CCGGCAATAACAGAAGCCGAAGAAACTCGAGTTTCTTCGGCTTCTGTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128249    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152324.1-193s1c1
Sequence:CCGGGATGTTCCTCTGTATGACATTCTCGAGAATGTCATACAGAGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-285s1c1
Sequence:CCGGGAAAGCGGTTCCCATTTACATCTCGAGATGTAAATGGGAACCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-516s1c1
Sequence:CCGGGATGAAGAGTGACGAGGATAACTCGAGTTATCCTCGTCACTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152324.1-177s1c1
Sequence:CCGGGCAATTCACAGTGTGTGATGTCTCGAGACATCACACACTGTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029326
TEX29 MISSION shRNA Bacterial Glycerol Stock
testis expressed 29
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029326.1-336s1c1
Sequence:CCGGCAGGTGTTCTTCACTCTGATTCTCGAGAATCAGAGTGAAGAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029326.1-233s1c1
Sequence:CCGGGTATGACATCTGTGACTACAACTCGAGTTGTAGTCACAGATGTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-599s1c1
Sequence:CCGGGATGAAATCCAAACCAGCGAACTCGAGTTCGCTGGTTTGGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-384s1c1
Sequence:CCGGGCCGTCATTTATAGGGTTATACTCGAGTATAACCCTATAAATGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-325s1c1
Sequence:CCGGCCATTTATGTACAGGTGTTCTCTCGAGAGAACACCTGTACATAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-192s1c1
Sequence:CCGGCCACATCTCCTGAAGAAGTTTCTCGAGAAACTTCTTCAGGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-312s1c1
Sequence:CCGGGAGAAAGCTGTTCCCATTTATCTCGAGATAAATGGGAACAGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029326.1-446s1c1
Sequence:CCGGCTCACAGGTTGAAATACTGAACTCGAGTTCAGTATTTCAACCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029326
TEX29 MISSION shRNA shRNA Plasmid DNA
testis expressed 29
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029326.1-336s1c1
Sequence:CCGGCAGGTGTTCTTCACTCTGATTCTCGAGAATCAGAGTGAAGAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029326.1-233s1c1
Sequence:CCGGGTATGACATCTGTGACTACAACTCGAGTTGTAGTCACAGATGTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-599s1c1
Sequence:CCGGGATGAAATCCAAACCAGCGAACTCGAGTTCGCTGGTTTGGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-384s1c1
Sequence:CCGGGCCGTCATTTATAGGGTTATACTCGAGTATAACCCTATAAATGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-325s1c1
Sequence:CCGGCCATTTATGTACAGGTGTTCTCTCGAGAGAACACCTGTACATAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-192s1c1
Sequence:CCGGCCACATCTCCTGAAGAAGTTTCTCGAGAAACTTCTTCAGGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-312s1c1
Sequence:CCGGGAGAAAGCTGTTCCCATTTATCTCGAGATAAATGGGAACAGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029326.1-446s1c1
Sequence:CCGGCTCACAGGTTGAAATACTGAACTCGAGTTCAGTATTTCAACCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029326
TEX29 MISSION shRNA Lentiviral Transduction Particles
testis expressed 29
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029326.1-336s1c1
Sequence:CCGGCAGGTGTTCTTCACTCTGATTCTCGAGAATCAGAGTGAAGAACACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029326.1-233s1c1
Sequence:CCGGGTATGACATCTGTGACTACAACTCGAGTTGTAGTCACAGATGTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-599s1c1
Sequence:CCGGGATGAAATCCAAACCAGCGAACTCGAGTTCGCTGGTTTGGATTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-384s1c1
Sequence:CCGGGCCGTCATTTATAGGGTTATACTCGAGTATAACCCTATAAATGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-325s1c1
Sequence:CCGGCCATTTATGTACAGGTGTTCTCTCGAGAGAACACCTGTACATAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-192s1c1
Sequence:CCGGCCACATCTCCTGAAGAAGTTTCTCGAGAAACTTCTTCAGGAGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029326.1-312s1c1
Sequence:CCGGGAGAAAGCTGTTCCCATTTATCTCGAGATAAATGGGAACAGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029326.1-446s1c1
Sequence:CCGGCTCACAGGTTGAAATACTGAACTCGAGTTCAGTATTTCAACCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks