EMAIL THIS PAGE TO A FRIEND

TEX2

testis expressed 2

Synonyms: HT008 TMEM96
UniProtKB ID: Q8IWB9, Q6AHZ5, Q8N3L0, Q9C0C5
Gene ID:
Mouse(21763) testis expressed gene 2
Rat(303611) testis expressed 2
cow(513262) testis expressed 2
sheep(101105011) testis expressed 2
domestic guinea pig(100733671) testis expressed 2
naked mole-rat(101715353) testis expressed 2
Domestic Rabbit(100350779) testis expressed 2
Zebrafish(798401) testis expressed 2
chicken(417415) testis expressed 2
domestic cat(101099161) testis expressed 2
dog(480474) testis expressed 2
159 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018469 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041721 MISSION® esiRNA esiRNA human TEX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018469 Rosetta Predictions human pricing
XM_001069235 Rosetta Predictions rat pricing
XM_001081600 Rosetta Predictions rat pricing
XM_001081602 Rosetta Predictions rat pricing
XM_001081604 Rosetta Predictions rat pricing
XM_001081606 Rosetta Predictions rat pricing
XM_221043 Rosetta Predictions rat pricing
NM_198292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023350 predicted 1008
2 SASI_Hs01_00023351 predicted 1145
3 SASI_Hs01_00023352 predicted 2639
4 SASI_Hs01_00023353 predicted 1627
5 SASI_Hs01_00023354 predicted 3369
6 SASI_Hs02_00352034 predicted 1495
7 SASI_Hs02_00352035 predicted 2910
8 SASI_Hs02_00352036 predicted 3404
9 SASI_Hs01_00023356 predicted 2266
10 SASI_Hs01_00023358 predicted 2808
11 SASI_Hs01_00023355 predicted 3372
12 SASI_Hs01_00023357 predicted 3121
13 SASI_Hs01_00023359 predicted 2204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069235 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327343 predicted 3580
2 SASI_Rn02_00327344 predicted 2615
3 SASI_Rn02_00327345 predicted 2259
4 SASI_Rn02_00327346 predicted 3106
5 SASI_Rn02_00327347 predicted 2840
6 SASI_Rn02_00327348 predicted 3412
7 SASI_Rn02_00327349 predicted 3097
8 SASI_Rn02_00327350 predicted 1022
9 SASI_Rn02_00327351 predicted 2790
10 SASI_Rn02_00327352 predicted 3546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372589 predicted 3242
2 SASI_Rn02_00372590 predicted 2563
3 SASI_Rn02_00372591 predicted 2204
4 SASI_Rn02_00372592 predicted 3051
5 SASI_Rn02_00372593 predicted 2791
6 SASI_Rn02_00372594 predicted 2843
7 SASI_Rn02_00372595 predicted 3049
8 SASI_Rn02_00372596 predicted 970
9 SASI_Rn02_00372597 predicted 1505
10 SASI_Rn02_00372598 predicted 2746
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372609 predicted 3554
2 SASI_Rn02_00372610 predicted 2592
3 SASI_Rn02_00372611 predicted 3078
4 SASI_Rn02_00372612 predicted 2814
5 SASI_Rn02_00372613 predicted 3376
6 SASI_Rn02_00372614 predicted 3069
7 SASI_Rn02_00372615 predicted 967
8 SASI_Rn02_00372616 predicted 2759
9 SASI_Rn02_00372617 predicted 3515
10 SASI_Rn02_00372618 predicted 2799
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372629 predicted 3524
2 SASI_Rn02_00372630 predicted 2568
3 SASI_Rn02_00372631 predicted 2206
4 SASI_Rn02_00372632 predicted 3050
5 SASI_Rn02_00372633 predicted 2794
6 SASI_Rn02_00372634 predicted 3349
7 SASI_Rn02_00372635 predicted 3039
8 SASI_Rn02_00372636 predicted 968
9 SASI_Rn02_00372637 predicted 2743
10 SASI_Rn02_00372638 predicted 3492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00372649 predicted 3549
2 SASI_Rn02_00372650 predicted 2587
3 SASI_Rn02_00372651 predicted 2221
4 SASI_Rn02_00372652 predicted 3075
5 SASI_Rn02_00372653 predicted 2807
6 SASI_Rn02_00372654 predicted 3373
7 SASI_Rn02_00372655 predicted 3066
8 SASI_Rn02_00372656 predicted 990
9 SASI_Rn02_00372657 predicted 2763
10 SASI_Rn02_00372658 predicted 3511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221043 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379774 predicted 3568
2 SASI_Rn02_00379775 predicted 2606
3 SASI_Rn02_00379776 predicted 2246
4 SASI_Rn02_00379777 predicted 3088
5 SASI_Rn02_00379778 predicted 2834
6 SASI_Rn02_00379779 predicted 3394
7 SASI_Rn02_00379780 predicted 3082
8 SASI_Rn02_00379781 predicted 1010
9 SASI_Rn02_00379782 predicted 2780
10 SASI_Rn02_00379783 predicted 3529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350904 predicted 1092
2 SASI_Mm01_00157504 predicted 3052
3 SASI_Mm01_00157505 predicted 3139
4 SASI_Mm01_00157506 predicted 2786
5 SASI_Mm01_00157507 predicted 2151
6 SASI_Mm01_00157509 predicted 3356
7 SASI_Mm01_00157510 predicted 2014
8 SASI_Mm01_00157511 predicted 3494
9 SASI_Mm01_00157512 predicted 1700
10 SASI_Mm01_00157513 predicted 2777
11 SASI_Mm01_00157508 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018469
VALIDATED
TEX2 MISSION shRNA Bacterial Glycerol Stock
testis expressed 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018469.3-3267s21c1
Sequence:CCGGGAACCTTGGCGGTCAACATTCCTCGAGGAATGTTGACCGCCAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018469.3-2196s21c1
Sequence:CCGGAGCGAGATCAGATACTCTATCCTCGAGGATAGAGTATCTGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018469.3-839s21c1
Sequence:CCGGTCGGATACAGTGTCCTATAAGCTCGAGCTTATAGGACACTGTATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018469.3-4068s21c1
Sequence:CCGGGAGATGGGCAGAGCAACTTATCTCGAGATAAGTTGCTCTGCCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018469.3-1700s21c1
Sequence:CCGGACACCACCAAGTGCTCATAAACTCGAGTTTATGAGCACTTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018469.3-962s1c1
Sequence:CCGGCCCTCTGATACTCGTTCCTTTCTCGAGAAAGGAACGAGTATCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018469.3-2855s1c1
Sequence:CCGGGATTTGGAAATGTCCTACAATCTCGAGATTGTAGGACATTTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018469.3-3449s1c1
Sequence:CCGGCCAAACATGGATGATGTTTATCTCGAGATAAACATCATCCATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018469
VALIDATED
TEX2 MISSION shRNA shRNA Plasmid DNA
testis expressed 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018469.3-3267s21c1
Sequence:CCGGGAACCTTGGCGGTCAACATTCCTCGAGGAATGTTGACCGCCAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018469.3-2196s21c1
Sequence:CCGGAGCGAGATCAGATACTCTATCCTCGAGGATAGAGTATCTGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018469.3-839s21c1
Sequence:CCGGTCGGATACAGTGTCCTATAAGCTCGAGCTTATAGGACACTGTATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018469.3-4068s21c1
Sequence:CCGGGAGATGGGCAGAGCAACTTATCTCGAGATAAGTTGCTCTGCCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018469.3-1700s21c1
Sequence:CCGGACACCACCAAGTGCTCATAAACTCGAGTTTATGAGCACTTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018469.3-962s1c1
Sequence:CCGGCCCTCTGATACTCGTTCCTTTCTCGAGAAAGGAACGAGTATCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018469.3-2855s1c1
Sequence:CCGGGATTTGGAAATGTCCTACAATCTCGAGATTGTAGGACATTTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018469.3-3449s1c1
Sequence:CCGGCCAAACATGGATGATGTTTATCTCGAGATAAACATCATCCATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018469
VALIDATED
TEX2 MISSION shRNA Lentiviral Transduction Particles
testis expressed 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018469.3-3267s21c1
Sequence:CCGGGAACCTTGGCGGTCAACATTCCTCGAGGAATGTTGACCGCCAAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018469.3-2196s21c1
Sequence:CCGGAGCGAGATCAGATACTCTATCCTCGAGGATAGAGTATCTGATCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018469.3-839s21c1
Sequence:CCGGTCGGATACAGTGTCCTATAAGCTCGAGCTTATAGGACACTGTATCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018469.3-4068s21c1
Sequence:CCGGGAGATGGGCAGAGCAACTTATCTCGAGATAAGTTGCTCTGCCCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018469.3-1700s21c1
Sequence:CCGGACACCACCAAGTGCTCATAAACTCGAGTTTATGAGCACTTGGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018469.3-962s1c1
Sequence:CCGGCCCTCTGATACTCGTTCCTTTCTCGAGAAAGGAACGAGTATCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167759    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018469.3-2855s1c1
Sequence:CCGGGATTTGGAAATGTCCTACAATCTCGAGATTGTAGGACATTTCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018469.3-3449s1c1
Sequence:CCGGCCAAACATGGATGATGTTTATCTCGAGATAAACATCATCCATGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198292
VALIDATED
TEX2 MISSION shRNA Bacterial Glycerol Stock
testis expressed 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-2599s21c1
Sequence:CCGGGGGACTTCTTGGGCGAGAAATCTCGAGATTTCTCGCCCAAGAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.3-3379s1c1
Sequence:CCGGCAAACATGGATGACGTTTATACTCGAGTATAAACGTCATCCATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-3379s21c1
Sequence:CCGGCAAACATGGATGACGTTTATACTCGAGTATAAACGTCATCCATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-4141s21c1
Sequence:CCGGCCATCCCAAAGACGTACAATCCTCGAGGATTGTACGTCTTTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-2839s21c1
Sequence:CCGGACTTGACCAAACTAGGTAAAGCTCGAGCTTTACCTAGTTTGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198292.3-1710s21c1
Sequence:CCGGGACATCAAGGAGCCCGAAATACTCGAGTATTTCGGGCTCCTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.2-2783s1c1
Sequence:CCGGCGATTTGGAAATGTCTTACAACTCGAGTTGTAAGACATTTCCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.2-1493s1c1
Sequence:CCGGGCACCAGGAGTTACCTGTAAACTCGAGTTTACAGGTAACTCCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.2-1933s1c1
Sequence:CCGGGCAAGATTTATCTTGTACCTACTCGAGTAGGTACAAGATAAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198292
VALIDATED
TEX2 MISSION shRNA shRNA Plasmid DNA
testis expressed 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-2599s21c1
Sequence:CCGGGGGACTTCTTGGGCGAGAAATCTCGAGATTTCTCGCCCAAGAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.3-3379s1c1
Sequence:CCGGCAAACATGGATGACGTTTATACTCGAGTATAAACGTCATCCATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-3379s21c1
Sequence:CCGGCAAACATGGATGACGTTTATACTCGAGTATAAACGTCATCCATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-4141s21c1
Sequence:CCGGCCATCCCAAAGACGTACAATCCTCGAGGATTGTACGTCTTTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-2839s21c1
Sequence:CCGGACTTGACCAAACTAGGTAAAGCTCGAGCTTTACCTAGTTTGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198292.3-1710s21c1
Sequence:CCGGGACATCAAGGAGCCCGAAATACTCGAGTATTTCGGGCTCCTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.2-2783s1c1
Sequence:CCGGCGATTTGGAAATGTCTTACAACTCGAGTTGTAAGACATTTCCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.2-1493s1c1
Sequence:CCGGGCACCAGGAGTTACCTGTAAACTCGAGTTTACAGGTAACTCCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.2-1933s1c1
Sequence:CCGGGCAAGATTTATCTTGTACCTACTCGAGTAGGTACAAGATAAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198292
VALIDATED
TEX2 MISSION shRNA Lentiviral Transduction Particles
testis expressed 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-2599s21c1
Sequence:CCGGGGGACTTCTTGGGCGAGAAATCTCGAGATTTCTCGCCCAAGAAGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.3-3379s1c1
Sequence:CCGGCAAACATGGATGACGTTTATACTCGAGTATAAACGTCATCCATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-3379s21c1
Sequence:CCGGCAAACATGGATGACGTTTATACTCGAGTATAAACGTCATCCATGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-4141s21c1
Sequence:CCGGCCATCCCAAAGACGTACAATCCTCGAGGATTGTACGTCTTTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_198292.3-2839s21c1
Sequence:CCGGACTTGACCAAACTAGGTAAAGCTCGAGCTTTACCTAGTTTGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198292.3-1710s21c1
Sequence:CCGGGACATCAAGGAGCCCGAAATACTCGAGTATTTCGGGCTCCTTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.2-2783s1c1
Sequence:CCGGCGATTTGGAAATGTCTTACAACTCGAGTTGTAAGACATTTCCAAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.2-1493s1c1
Sequence:CCGGGCACCAGGAGTTACCTGTAAACTCGAGTTTACAGGTAACTCCTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198292.2-1933s1c1
Sequence:CCGGGCAAGATTTATCTTGTACCTACTCGAGTAGGTACAAGATAAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks