EMAIL THIS PAGE TO A FRIEND

TEX30

testis expressed 30

Synonyms: C13orf27
UniProtKB ID: Q5JUR7, Q96KZ8
Gene ID:
Mouse(75623) testis expressed 30
Rat(301381) testis expressed 30
cow(613895) testis expressed 30
sheep(101113769) testis expressed 30
domestic guinea pig(100720285) testis expressed 30
naked mole-rat(101699394) testis expressed 30
Zebrafish(567483) testis expressed 30
domestic cat(101085429) testis expressed 30
dog(611593) testis expressed 30
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138779 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029368 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029368 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029368 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138779 Rosetta Predictions human pricing
NM_001106909 Rosetta Predictions rat pricing
XM_355303 Rosetta Predictions mouse pricing
XM_891726 Rosetta Predictions mouse pricing
XM_899714 Rosetta Predictions mouse pricing
XM_899731 Rosetta Predictions mouse pricing
XM_899737 Rosetta Predictions mouse pricing
XM_899751 Rosetta Predictions mouse pricing
XM_899759 Rosetta Predictions mouse pricing
XM_899774 Rosetta Predictions mouse pricing
XM_899782 Rosetta Predictions mouse pricing
XM_919059 Rosetta Predictions mouse pricing
XM_919077 Rosetta Predictions mouse pricing
XM_919088 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131765 predicted 355
2 SASI_Hs01_00131766 predicted 735
3 SASI_Hs01_00131767 predicted 899
4 SASI_Hs01_00131768 predicted 545
5 SASI_Hs01_00131769 predicted 884
6 SASI_Hs01_00131770 predicted 752
7 SASI_Hs01_00131771 predicted 678
8 SASI_Hs01_00131772 predicted 379
9 SASI_Hs01_00131773 predicted 301
10 SASI_Hs02_00363902 predicted 720
11 SASI_Hs01_00131774 predicted 887
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223596 predicted 933
2 SASI_Rn02_00223597 predicted 402
3 SASI_Rn02_00223598 predicted 414
4 SASI_Rn02_00223599 predicted 706
5 SASI_Rn02_00223600 predicted 902
6 SASI_Rn02_00223601 predicted 546
7 SASI_Rn02_00223602 predicted 1077
8 SASI_Rn02_00223603 predicted 394
9 SASI_Rn02_00223604 predicted 1080
10 SASI_Rn02_00223605 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239518 predicted 990
2 SASI_Mm01_00239519 predicted 971
3 SASI_Mm01_00239520 predicted 1052
4 SASI_Mm01_00239521 predicted 873
5 SASI_Mm01_00239522 predicted 1082
6 SASI_Mm01_00239523 predicted 1053
7 SASI_Mm01_00239524 predicted 1037
8 SASI_Mm01_00239525 predicted 941
9 SASI_Mm01_00239526 predicted 1045
10 SASI_Mm01_00239527 predicted 1050
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_891726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249173 predicted 558
2 SASI_Mm01_00249174 predicted 528
3 SASI_Mm01_00249175 predicted 614
4 SASI_Mm01_00249176 predicted 444
5 SASI_Mm01_00249177 predicted 385
6 SASI_Mm01_00249178 predicted 403
7 SASI_Mm01_00249179 predicted 374
8 SASI_Mm01_00249180 predicted 513
9 SASI_Mm01_00249181 predicted 611
10 SASI_Mm01_00249182 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233947 predicted 465
2 SASI_Mm01_00233948 predicted 450
3 SASI_Mm01_00233949 predicted 537
4 SASI_Mm01_00233950 predicted 358
5 SASI_Mm01_00233951 predicted 560
6 SASI_Mm01_00233952 predicted 537
7 SASI_Mm01_00233953 predicted 311
8 SASI_Mm01_00233954 predicted 516
9 SASI_Mm01_00233955 predicted 427
10 SASI_Mm01_00233956 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278363 predicted 720
2 SASI_Mm01_00278364 predicted 699
3 SASI_Mm01_00278365 predicted 782
4 SASI_Mm01_00278366 predicted 605
5 SASI_Mm01_00278367 predicted 552
6 SASI_Mm01_00278368 predicted 563
7 SASI_Mm01_00278369 predicted 538
8 SASI_Mm01_00278370 predicted 675
9 SASI_Mm01_00278371 predicted 777
10 SASI_Mm01_00278372 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227058 predicted 649
2 SASI_Mm01_00227059 predicted 634
3 SASI_Mm01_00227060 predicted 710
4 SASI_Mm01_00227061 predicted 539
5 SASI_Mm01_00227062 predicted 748
6 SASI_Mm01_00227063 predicted 709
7 SASI_Mm01_00227064 predicted 699
8 SASI_Mm01_00227065 predicted 606
9 SASI_Mm01_00227066 predicted 713
10 SASI_Mm01_00227067 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266474 predicted 599
2 SASI_Mm01_00266475 predicted 584
3 SASI_Mm01_00266476 predicted 670
4 SASI_Mm01_00266477 predicted 495
5 SASI_Mm01_00266478 predicted 435
6 SASI_Mm01_00266479 predicted 447
7 SASI_Mm01_00266480 predicted 421
8 SASI_Mm01_00266481 predicted 559
9 SASI_Mm01_00266482 predicted 666
10 SASI_Mm01_00266483 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227771 predicted 622
2 SASI_Mm01_00227773 predicted 686
3 SASI_Mm01_00227774 predicted 510
4 SASI_Mm01_00227775 predicted 451
5 SASI_Mm02_00430061 predicted 685
6 SASI_Mm01_00227776 predicted 465
7 SASI_Mm01_00227779 predicted 677
8 SASI_Mm02_00430062 predicted 454
9 SASI_Mm02_00430063 predicted 683
10 SASI_Mm02_00430064 predicted 406
11 SASI_Mm01_00227772 predicted 601
12 SASI_Mm01_00227777 predicted 449
13 SASI_Mm01_00227778 predicted 580
14 SASI_Mm01_00227780 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246372 predicted 594
2 SASI_Mm02_00430065 predicted 659
3 SASI_Mm02_00430066 predicted 478
4 SASI_Mm02_00430067 predicted 430
5 SASI_Mm02_00430068 predicted 654
6 SASI_Mm01_00246376 predicted 434
7 SASI_Mm01_00246380 predicted 652
8 SASI_Mm02_00430069 predicted 427
9 SASI_Mm02_00430070 predicted 654
10 SASI_Mm02_00430071 predicted 376
11 SASI_Mm01_00246373 predicted 284
12 SASI_Mm01_00246374 predicted 301
13 SASI_Mm01_00246375 predicted 307
14 SASI_Mm01_00246377 predicted 286
15 SASI_Mm01_00246378 predicted 417
16 SASI_Mm01_00246379 predicted 553
17 SASI_Mm01_00246381 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276741 predicted 680
2 SASI_Mm01_00276743 predicted 750
3 SASI_Mm01_00276744 predicted 575
4 SASI_Mm01_00276745 predicted 515
5 SASI_Mm02_00430072 predicted 750
6 SASI_Mm01_00276746 predicted 531
7 SASI_Mm01_00276749 predicted 741
8 SASI_Mm02_00430073 predicted 516
9 SASI_Mm02_00430074 predicted 751
10 SASI_Mm02_00430075 predicted 477
11 SASI_Mm01_00276742 predicted 664
12 SASI_Mm01_00276747 predicted 512
13 SASI_Mm01_00276748 predicted 635
14 SASI_Mm01_00276750 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442108 predicted 316
2 SASI_Mm02_00442109 predicted 337
3 SASI_Mm02_00442110 predicted 629
4 SASI_Mm02_00442111 predicted 587
5 SASI_Mm02_00442112 predicted 462
6 SASI_Mm02_00442113 predicted 301
7 SASI_Mm02_00442114 predicted 453
8 SASI_Mm02_00442115 predicted 657
9 SASI_Mm02_00442116 predicted 383
10 SASI_Mm02_00442117 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442118 predicted 292
2 SASI_Mm02_00442119 predicted 304
3 SASI_Mm02_00442120 predicted 594
4 SASI_Mm02_00442121 predicted 559
5 SASI_Mm02_00442122 predicted 440
6 SASI_Mm02_00442123 predicted 280
7 SASI_Mm02_00442124 predicted 423
8 SASI_Mm02_00442125 predicted 626
9 SASI_Mm02_00442126 predicted 361
10 SASI_Mm02_00442127 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_919088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442158 predicted 379
2 SASI_Mm02_00442159 predicted 401
3 SASI_Mm02_00442160 predicted 688
4 SASI_Mm02_00442161 predicted 648
5 SASI_Mm02_00442162 predicted 530
6 SASI_Mm02_00442163 predicted 372
7 SASI_Mm02_00442164 predicted 512
8 SASI_Mm02_00442165 predicted 720
9 SASI_Mm02_00442166 predicted 448
10 SASI_Mm02_00442167 predicted 1043
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138779
VALIDATED
TEX30 MISSION shRNA Bacterial Glycerol Stock
testis expressed 30
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-1027s1c1
Sequence:CCGGGCACTGTTACAGTTGTATAAACTCGAGTTTATACAACTGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-322s1c1
Sequence:CCGGGCATCCCATCTTGCATCTCATCTCGAGATGAGATGCAAGATGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138779.2-350s1c1
Sequence:CCGGTCTGCCTGAGATTTACCTGTACTCGAGTACAGGTAAATCTCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-723s1c1
Sequence:CCGGCCACTGGATTGAGAAGGCAAACTCGAGTTTGCCTTCTCAATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-496s1c1
Sequence:CCGGGCTTCTGTAATGTGTCACATTCTCGAGAATGTGACACATTACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_138779.3-613s21c1
Sequence:CCGGTGAAGACCTCTTTCGTTTAAACTCGAGTTTAAACGAAAGAGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138779.3-1034s21c1
Sequence:CCGGGCACTGTTACAGTTGTATAAACTCGAGTTTATACAACTGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138779.3-329s21c1
Sequence:CCGGGCATCCCATCTTGCATCTCATCTCGAGATGAGATGCAAGATGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138779.3-395s21c1
Sequence:CCGGCATAGAATTAAGGCGTATAAACTCGAGTTTATACGCCTTAATTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_138779.3-730s21c1
Sequence:CCGGCCACTGGATTGAGAAGGCAAACTCGAGTTTGCCTTCTCAATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138779
VALIDATED
TEX30 MISSION shRNA shRNA Plasmid DNA
testis expressed 30
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-1027s1c1
Sequence:CCGGGCACTGTTACAGTTGTATAAACTCGAGTTTATACAACTGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-322s1c1
Sequence:CCGGGCATCCCATCTTGCATCTCATCTCGAGATGAGATGCAAGATGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138779.2-350s1c1
Sequence:CCGGTCTGCCTGAGATTTACCTGTACTCGAGTACAGGTAAATCTCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-723s1c1
Sequence:CCGGCCACTGGATTGAGAAGGCAAACTCGAGTTTGCCTTCTCAATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-496s1c1
Sequence:CCGGGCTTCTGTAATGTGTCACATTCTCGAGAATGTGACACATTACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_138779.3-613s21c1
Sequence:CCGGTGAAGACCTCTTTCGTTTAAACTCGAGTTTAAACGAAAGAGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138779.3-1034s21c1
Sequence:CCGGGCACTGTTACAGTTGTATAAACTCGAGTTTATACAACTGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138779.3-329s21c1
Sequence:CCGGGCATCCCATCTTGCATCTCATCTCGAGATGAGATGCAAGATGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138779.3-395s21c1
Sequence:CCGGCATAGAATTAAGGCGTATAAACTCGAGTTTATACGCCTTAATTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_138779.3-730s21c1
Sequence:CCGGCCACTGGATTGAGAAGGCAAACTCGAGTTTGCCTTCTCAATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138779
VALIDATED
TEX30 MISSION shRNA Lentiviral Transduction Particles
testis expressed 30
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-1027s1c1
Sequence:CCGGGCACTGTTACAGTTGTATAAACTCGAGTTTATACAACTGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-322s1c1
Sequence:CCGGGCATCCCATCTTGCATCTCATCTCGAGATGAGATGCAAGATGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138779.2-350s1c1
Sequence:CCGGTCTGCCTGAGATTTACCTGTACTCGAGTACAGGTAAATCTCAGGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-723s1c1
Sequence:CCGGCCACTGGATTGAGAAGGCAAACTCGAGTTTGCCTTCTCAATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_138779.2-496s1c1
Sequence:CCGGGCTTCTGTAATGTGTCACATTCTCGAGAATGTGACACATTACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_138779.3-613s21c1
Sequence:CCGGTGAAGACCTCTTTCGTTTAAACTCGAGTTTAAACGAAAGAGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138779.3-1034s21c1
Sequence:CCGGGCACTGTTACAGTTGTATAAACTCGAGTTTATACAACTGTAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138779.3-329s21c1
Sequence:CCGGGCATCCCATCTTGCATCTCATCTCGAGATGAGATGCAAGATGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138779.3-395s21c1
Sequence:CCGGCATAGAATTAAGGCGTATAAACTCGAGTTTATACGCCTTAATTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_138779.3-730s21c1
Sequence:CCGGCCACTGGATTGAGAAGGCAAACTCGAGTTTGCCTTCTCAATCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029368
VALIDATED
TEX30 MISSION shRNA Bacterial Glycerol Stock
testis expressed 30
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-506s21c1
Sequence:CCGGTACTTGCAAAGGCCTTAATATCTCGAGATATTAAGGCCTTTGCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-1090s21c1
Sequence:CCGGTTCTTTAATGTTGCCCTATTTCTCGAGAAATAGGGCAACATTAAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-749s21c1
Sequence:CCGGCGAAGATCTCTTTCGTATAAACTCGAGTTTATACGAAAGAGATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-908s21c1
Sequence:CCGGACGGTCTACAAATGATGTATTCTCGAGAATACATCATTTGTAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-788s21c1
Sequence:CCGGGTCGGGCTCAGCAGATGAAATCTCGAGATTTCATCTGCTGAGCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029368
VALIDATED
TEX30 MISSION shRNA shRNA Plasmid DNA
testis expressed 30
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-506s21c1
Sequence:CCGGTACTTGCAAAGGCCTTAATATCTCGAGATATTAAGGCCTTTGCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-1090s21c1
Sequence:CCGGTTCTTTAATGTTGCCCTATTTCTCGAGAAATAGGGCAACATTAAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-749s21c1
Sequence:CCGGCGAAGATCTCTTTCGTATAAACTCGAGTTTATACGAAAGAGATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-908s21c1
Sequence:CCGGACGGTCTACAAATGATGTATTCTCGAGAATACATCATTTGTAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-788s21c1
Sequence:CCGGGTCGGGCTCAGCAGATGAAATCTCGAGATTTCATCTGCTGAGCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029368
VALIDATED
TEX30 MISSION shRNA Lentiviral Transduction Particles
testis expressed 30
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-506s21c1
Sequence:CCGGTACTTGCAAAGGCCTTAATATCTCGAGATATTAAGGCCTTTGCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-1090s21c1
Sequence:CCGGTTCTTTAATGTTGCCCTATTTCTCGAGAAATAGGGCAACATTAAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-749s21c1
Sequence:CCGGCGAAGATCTCTTTCGTATAAACTCGAGTTTATACGAAAGAGATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-908s21c1
Sequence:CCGGACGGTCTACAAATGATGTATTCTCGAGAATACATCATTTGTAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029368.1-788s21c1
Sequence:CCGGGTCGGGCTCAGCAGATGAAATCTCGAGATTTCATCTGCTGAGCCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks