EMAIL THIS PAGE TO A FRIEND

TEX33

testis expressed 33

Synonyms: C22orf33 EAN57 cE81G9.2
UniProtKB ID: O43247, B1AH46, Q6ICF2, Q8IVQ2, Q9Y4V8
Gene ID:
Mouse(73376) testis expressed 33
Rat(686841) testis expressed 33
domestic cat(101095754) testis expressed 33
dog(474516) testis expressed 33
naked mole-rat(101724634) testis expressed 33
cow(767965) testis expressed 33
sheep(101123456) testis expressed 33
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178552 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036061 MISSION® esiRNA esiRNA human C22orf33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178552 Rosetta Predictions human pricing
NM_001044289 Rosetta Predictions rat pricing
XM_181371 Rosetta Predictions mouse pricing
XM_911673 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068599 predicted 373
2 SASI_Hs02_00369799 predicted 663
3 SASI_Hs01_00068600 predicted 503
4 SASI_Hs01_00068601 predicted 644
5 SASI_Hs01_00068602 predicted 687
6 SASI_Hs01_00068603 predicted 520
7 SASI_Hs01_00068604 predicted 661
8 SASI_Hs01_00068605 predicted 700
9 SASI_Hs01_00068606 predicted 519
10 SASI_Hs01_00068607 predicted 516
11 SASI_Hs01_00068608 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205564 predicted 198
2 SASI_Rn02_00205565 predicted 603
3 SASI_Rn02_00205566 predicted 596
4 SASI_Rn02_00205567 predicted 285
5 SASI_Rn02_00205568 predicted 745
6 SASI_Rn02_00205569 predicted 282
7 SASI_Rn02_00205570 predicted 612
8 SASI_Rn02_00205571 predicted 703
9 SASI_Rn02_00205572 predicted 287
10 SASI_Rn02_00205573 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_181371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425455 predicted 592
2 SASI_Mm01_00257727 predicted 651
3 SASI_Mm02_00425456 predicted 545
4 SASI_Mm01_00257728 predicted 647
5 SASI_Mm01_00257729 predicted 459
6 SASI_Mm01_00257730 predicted 607
7 SASI_Mm01_00257731 predicted 612
8 SASI_Mm01_00257732 predicted 485
9 SASI_Mm01_00257733 predicted 623
10 SASI_Mm02_00425457 predicted 575
11 SASI_Mm01_00257734 predicted 477
12 SASI_Mm01_00257735 predicted 403
13 SASI_Mm01_00257736 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911673 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436545 predicted 717
2 SASI_Mm02_00436546 predicted 647
3 SASI_Mm02_00436547 predicted 462
4 SASI_Mm02_00436548 predicted 763
5 SASI_Mm02_00436549 predicted 609
6 SASI_Mm02_00436550 predicted 816
7 SASI_Mm02_00436551 predicted 489
8 SASI_Mm02_00436552 predicted 212
9 SASI_Mm02_00436553 predicted 620
10 SASI_Mm02_00436554 predicted 686
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163612
TEX33 MISSION shRNA Bacterial Glycerol Stock
testis expressed 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-493s21c1
Sequence:CCGGCAGGACTTCTCTGGCTATGAACTCGAGTTCATAGCCAGAGAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-852s21c1
Sequence:CCGGACATGCGATCCAACTTGTTTCCTCGAGGAAACAAGTTGGATCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-357s21c1
Sequence:CCGGACTCCTTCAGAGCTAACCATACTCGAGTATGGTTAGCTCTGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-733s21c1
Sequence:CCGGTCGACAGGCCATTGGTGAAATCTCGAGATTTCACCAATGGCCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-669s21c1
Sequence:CCGGCTGAGAACATCCGCCACAAATCTCGAGATTTGTGGCGGATGTTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163612
TEX33 MISSION shRNA shRNA Plasmid DNA
testis expressed 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-493s21c1
Sequence:CCGGCAGGACTTCTCTGGCTATGAACTCGAGTTCATAGCCAGAGAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-852s21c1
Sequence:CCGGACATGCGATCCAACTTGTTTCCTCGAGGAAACAAGTTGGATCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-357s21c1
Sequence:CCGGACTCCTTCAGAGCTAACCATACTCGAGTATGGTTAGCTCTGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-733s21c1
Sequence:CCGGTCGACAGGCCATTGGTGAAATCTCGAGATTTCACCAATGGCCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-669s21c1
Sequence:CCGGCTGAGAACATCCGCCACAAATCTCGAGATTTGTGGCGGATGTTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163612
TEX33 MISSION shRNA Lentiviral Transduction Particles
testis expressed 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-493s21c1
Sequence:CCGGCAGGACTTCTCTGGCTATGAACTCGAGTTCATAGCCAGAGAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-852s21c1
Sequence:CCGGACATGCGATCCAACTTGTTTCCTCGAGGAAACAAGTTGGATCGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-357s21c1
Sequence:CCGGACTCCTTCAGAGCTAACCATACTCGAGTATGGTTAGCTCTGAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-733s21c1
Sequence:CCGGTCGACAGGCCATTGGTGAAATCTCGAGATTTCACCAATGGCCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163612.1-669s21c1
Sequence:CCGGCTGAGAACATCCGCCACAAATCTCGAGATTTGTGGCGGATGTTCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178552
TEX33 MISSION shRNA Bacterial Glycerol Stock
testis expressed 33
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-496s21c1
Sequence:CCGGACCAGAAGGGCAGCATCATTCCTCGAGGAATGATGCTGCCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-693s21c1
Sequence:CCGGGGCTACAACATGCGGTCAAACCTCGAGGTTTGACCGCATGTTGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-520s21c1
Sequence:CCGGACAACATTCGCCACAAGTTTGCTCGAGCAAACTTGTGGCGAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-666s21c1
Sequence:CCGGTCCGTCTTCTCAGACTACTATCTCGAGATAGTAGTCTGAGAAGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-760s21c1
Sequence:CCGGCTTACACACCAGAGGTCATTGCTCGAGCAATGACCTCTGGTGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178552.2-872s1c1
Sequence:CCGGGCAGAAAGCACTGGAAGAGAACTCGAGTTCTCTTCCAGTGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178552.2-782s1c1
Sequence:CCGGGAAATCAGTGAGGGACTTAGACTCGAGTCTAAGTCCCTCACTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178552.2-873s1c1
Sequence:CCGGCAGAAAGCACTGGAAGAGAAACTCGAGTTTCTCTTCCAGTGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178552
TEX33 MISSION shRNA shRNA Plasmid DNA
testis expressed 33
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-496s21c1
Sequence:CCGGACCAGAAGGGCAGCATCATTCCTCGAGGAATGATGCTGCCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-693s21c1
Sequence:CCGGGGCTACAACATGCGGTCAAACCTCGAGGTTTGACCGCATGTTGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-520s21c1
Sequence:CCGGACAACATTCGCCACAAGTTTGCTCGAGCAAACTTGTGGCGAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-666s21c1
Sequence:CCGGTCCGTCTTCTCAGACTACTATCTCGAGATAGTAGTCTGAGAAGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-760s21c1
Sequence:CCGGCTTACACACCAGAGGTCATTGCTCGAGCAATGACCTCTGGTGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178552.2-872s1c1
Sequence:CCGGGCAGAAAGCACTGGAAGAGAACTCGAGTTCTCTTCCAGTGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178552.2-782s1c1
Sequence:CCGGGAAATCAGTGAGGGACTTAGACTCGAGTCTAAGTCCCTCACTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178552.2-873s1c1
Sequence:CCGGCAGAAAGCACTGGAAGAGAAACTCGAGTTTCTCTTCCAGTGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178552
TEX33 MISSION shRNA Lentiviral Transduction Particles
testis expressed 33
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-496s21c1
Sequence:CCGGACCAGAAGGGCAGCATCATTCCTCGAGGAATGATGCTGCCCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-693s21c1
Sequence:CCGGGGCTACAACATGCGGTCAAACCTCGAGGTTTGACCGCATGTTGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-520s21c1
Sequence:CCGGACAACATTCGCCACAAGTTTGCTCGAGCAAACTTGTGGCGAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-666s21c1
Sequence:CCGGTCCGTCTTCTCAGACTACTATCTCGAGATAGTAGTCTGAGAAGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178552.2-760s21c1
Sequence:CCGGCTTACACACCAGAGGTCATTGCTCGAGCAATGACCTCTGGTGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178552.2-872s1c1
Sequence:CCGGGCAGAAAGCACTGGAAGAGAACTCGAGTTCTCTTCCAGTGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178552.2-782s1c1
Sequence:CCGGGAAATCAGTGAGGGACTTAGACTCGAGTCTAAGTCCCTCACTGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178552.2-873s1c1
Sequence:CCGGCAGAAAGCACTGGAAGAGAAACTCGAGTTTCTCTTCCAGTGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks