EMAIL THIS PAGE TO A FRIEND

TEX35

testis expressed 35

Synonyms: C1orf49 TSC24
Gene ID:
Mouse(73435) testis expressed 35
Rat(680164) testis expressed 35
domestic cat(101084159) testis expressed 35
cow(768066) testis expressed 35
sheep(101119658) testis expressed 35
domestic guinea pig(100726961) testis expressed 35
naked mole-rat(101709637) testis expressed 35
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032126 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028540 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028540 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028540 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094131 MISSION® esiRNA esiRNA human C1orf49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032126 Rosetta Predictions human pricing
XM_001055979 Rosetta Predictions rat pricing
NM_028540 Rosetta Predictions mouse pricing
XM_129568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046430 predicted 245
2 SASI_Hs01_00046431 predicted 244
3 SASI_Hs02_00359338 predicted 255
4 SASI_Hs02_00359339 predicted 252
5 SASI_Hs01_00046432 predicted 332
6 SASI_Hs01_00046433 predicted 226
7 SASI_Hs01_00046434 predicted 366
8 SASI_Hs01_00046435 predicted 492
9 SASI_Hs01_00046436 predicted 204
10 SASI_Hs01_00046437 predicted 665
11 SASI_Hs01_00046428 predicted 492
12 SASI_Hs01_00046429 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281634 predicted 466
2 SASI_Rn02_00281635 predicted 517
3 SASI_Rn02_00281636 predicted 511
4 SASI_Rn02_00281637 predicted 318
5 SASI_Rn02_00281638 predicted 495
6 SASI_Rn02_00281639 predicted 327
7 SASI_Rn02_00281640 predicted 367
8 SASI_Rn02_00281641 predicted 361
9 SASI_Rn02_00281642 predicted 528
10 SASI_Rn02_00281643 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028540 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334017 predicted 238
2 SASI_Mm02_00334018 predicted 291
3 SASI_Mm02_00334019 predicted 299
4 SASI_Mm02_00334020 predicted 508
5 SASI_Mm02_00334021 predicted 649
6 SASI_Mm02_00334022 predicted 496
7 SASI_Mm02_00334023 predicted 467
8 SASI_Mm02_00334024 predicted 325
9 SASI_Mm02_00334025 predicted 611
10 SASI_Mm02_00334026 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203286 predicted 218
2 SASI_Mm01_00203287 predicted 408
3 SASI_Mm01_00203288 predicted 223
4 SASI_Mm01_00203289 predicted 328
5 SASI_Mm01_00203290 predicted 334
6 SASI_Mm01_00203291 predicted 302
7 SASI_Mm01_00203292 predicted 234
8 SASI_Mm01_00203293 predicted 313
9 SASI_Mm01_00203294 predicted 317
10 SASI_Mm01_00203295 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032126
TEX35 MISSION shRNA Bacterial Glycerol Stock
testis expressed 35
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032126.1-157s1c1
Sequence:CCGGGCAAGAACTACAAGGCAGTTTCTCGAGAAACTGCCTTGTAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032126.1-393s1c1
Sequence:CCGGGAAATGCAGAAAGATATGGATCTCGAGATCCATATCTTTCTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-354s21c1
Sequence:CCGGTTGATAAACTTCACGAATTTGCTCGAGCAAATTCGTGAAGTTTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-207s21c1
Sequence:CCGGTTGATTACAAAGCAGTTAAACCTCGAGGTTTAACTGCTTTGTAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-543s21c1
Sequence:CCGGATGGAGCCAGTGGAGTCAATGCTCGAGCATTGACTCCACTGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-250s21c1
Sequence:CCGGAGGAGTGACACAGGACCTAAACTCGAGTTTAGGTCCTGTGTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032126.3-816s21c1
Sequence:CCGGGCTTAACTGCCAGCTTGAAATCTCGAGATTTCAAGCTGGCAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032126
TEX35 MISSION shRNA shRNA Plasmid DNA
testis expressed 35
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032126.1-157s1c1
Sequence:CCGGGCAAGAACTACAAGGCAGTTTCTCGAGAAACTGCCTTGTAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032126.1-393s1c1
Sequence:CCGGGAAATGCAGAAAGATATGGATCTCGAGATCCATATCTTTCTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-354s21c1
Sequence:CCGGTTGATAAACTTCACGAATTTGCTCGAGCAAATTCGTGAAGTTTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-207s21c1
Sequence:CCGGTTGATTACAAAGCAGTTAAACCTCGAGGTTTAACTGCTTTGTAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-543s21c1
Sequence:CCGGATGGAGCCAGTGGAGTCAATGCTCGAGCATTGACTCCACTGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-250s21c1
Sequence:CCGGAGGAGTGACACAGGACCTAAACTCGAGTTTAGGTCCTGTGTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032126.3-816s21c1
Sequence:CCGGGCTTAACTGCCAGCTTGAAATCTCGAGATTTCAAGCTGGCAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032126
TEX35 MISSION shRNA Lentiviral Transduction Particles
testis expressed 35
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032126.1-157s1c1
Sequence:CCGGGCAAGAACTACAAGGCAGTTTCTCGAGAAACTGCCTTGTAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032126.1-393s1c1
Sequence:CCGGGAAATGCAGAAAGATATGGATCTCGAGATCCATATCTTTCTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-354s21c1
Sequence:CCGGTTGATAAACTTCACGAATTTGCTCGAGCAAATTCGTGAAGTTTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-207s21c1
Sequence:CCGGTTGATTACAAAGCAGTTAAACCTCGAGGTTTAACTGCTTTGTAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-543s21c1
Sequence:CCGGATGGAGCCAGTGGAGTCAATGCTCGAGCATTGACTCCACTGGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032126.3-250s21c1
Sequence:CCGGAGGAGTGACACAGGACCTAAACTCGAGTTTAGGTCCTGTGTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032126.3-816s21c1
Sequence:CCGGGCTTAACTGCCAGCTTGAAATCTCGAGATTTCAAGCTGGCAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028540
TEX35 MISSION shRNA Bacterial Glycerol Stock
testis expressed 35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-145s21c1
Sequence:CCGGACCGAAGCTGACACAAATATACTCGAGTATATTTGTGTCAGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-582s21c1
Sequence:CCGGGTCAGAGTTGCTGCGAGAAATCTCGAGATTTCTCGCAGCAACTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-299s21c1
Sequence:CCGGATGGACAAAGATTTCGATAAACTCGAGTTTATCGAAATCTTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-688s21c1
Sequence:CCGGTGGAGCTGCTTTCTAATTTATCTCGAGATAAATTAGAAAGCAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028540.2-712s21c1
Sequence:CCGGTACTTCAACTTCGCCGAGGTGCTCGAGCACCTCGGCGAAGTTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028540
TEX35 MISSION shRNA shRNA Plasmid DNA
testis expressed 35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-145s21c1
Sequence:CCGGACCGAAGCTGACACAAATATACTCGAGTATATTTGTGTCAGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-582s21c1
Sequence:CCGGGTCAGAGTTGCTGCGAGAAATCTCGAGATTTCTCGCAGCAACTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-299s21c1
Sequence:CCGGATGGACAAAGATTTCGATAAACTCGAGTTTATCGAAATCTTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-688s21c1
Sequence:CCGGTGGAGCTGCTTTCTAATTTATCTCGAGATAAATTAGAAAGCAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028540.2-712s21c1
Sequence:CCGGTACTTCAACTTCGCCGAGGTGCTCGAGCACCTCGGCGAAGTTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028540
TEX35 MISSION shRNA Lentiviral Transduction Particles
testis expressed 35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-145s21c1
Sequence:CCGGACCGAAGCTGACACAAATATACTCGAGTATATTTGTGTCAGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-582s21c1
Sequence:CCGGGTCAGAGTTGCTGCGAGAAATCTCGAGATTTCTCGCAGCAACTCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-299s21c1
Sequence:CCGGATGGACAAAGATTTCGATAAACTCGAGTTTATCGAAATCTTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028540.2-688s21c1
Sequence:CCGGTGGAGCTGCTTTCTAATTTATCTCGAGATAAATTAGAAAGCAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268344    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028540.2-712s21c1
Sequence:CCGGTACTTCAACTTCGCCGAGGTGCTCGAGCACCTCGGCGAAGTTGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks