EMAIL THIS PAGE TO A FRIEND

TEX36

testis expressed 36

Synonyms: C10orf122 bA383C5.1
UniProtKB ID: Q5VZQ5, Q0P5T8
Gene ID:
Mouse(73808) testis expressed 36
Rat(499279) testis expressed 36
naked mole-rat(101703190) testis expressed 36
domestic guinea pig(100712885) testis expressed 36
sheep(101105375) testis expressed 36
dog(477861) testis expressed 36
domestic cat(101101256) testis expressed 36
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001128202 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001128202 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001128202 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128202 Rosetta Predictions human pricing
XM_370582 Rosetta Predictions human pricing
XM_926761 Rosetta Predictions human pricing
NM_001024288 Rosetta Predictions rat pricing
NM_028654 Rosetta Predictions mouse pricing
XM_133905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330776 predicted 441
2 SASI_Hs02_00330777 predicted 327
3 SASI_Hs02_00330778 predicted 589
4 SASI_Hs02_00330779 predicted 573
5 SASI_Hs02_00330780 predicted 492
6 SASI_Hs02_00330781 predicted 356
7 SASI_Hs02_00330782 predicted 322
8 SASI_Hs02_00330783 predicted 580
9 SASI_Hs02_00330784 predicted 439
10 SASI_Hs02_00330785 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00285947 predicted 407
2 SASI_Hs01_00285948 predicted 292
3 SASI_Hs01_00285949 predicted 489
4 SASI_Hs01_00285950 predicted 323
5 SASI_Hs01_00285951 predicted 283
6 SASI_Hs01_00285952 predicted 444
7 SASI_Hs01_00285953 predicted 459
8 SASI_Hs01_00285954 predicted 486
9 SASI_Hs01_00285955 predicted 258
10 SASI_Hs01_00285956 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_926761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290685 predicted 438
2 SASI_Hs01_00290686 predicted 323
3 SASI_Hs01_00290687 predicted 581
4 SASI_Hs01_00290688 predicted 575
5 SASI_Hs01_00290689 predicted 498
6 SASI_Hs01_00290690 predicted 357
7 SASI_Hs01_00290691 predicted 322
8 SASI_Hs01_00290692 predicted 577
9 SASI_Hs01_00290693 predicted 428
10 SASI_Hs01_00290694 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078944 predicted 397
2 SASI_Rn01_00078945 predicted 410
3 SASI_Rn01_00078946 predicted 444
4 SASI_Rn01_00078947 predicted 568
5 SASI_Rn01_00078948 predicted 222
6 SASI_Rn01_00078949 predicted 470
7 SASI_Rn01_00078950 predicted 522
8 SASI_Rn01_00078951 predicted 303
9 SASI_Rn01_00078952 predicted 275
10 SASI_Rn02_00202474 predicted 565
11 SASI_Rn01_00078953 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334170 predicted 511
2 SASI_Mm02_00334171 predicted 470
3 SASI_Mm02_00334172 predicted 326
4 SASI_Mm02_00334173 predicted 402
5 SASI_Mm02_00334174 predicted 323
6 SASI_Mm02_00334175 predicted 557
7 SASI_Mm02_00334176 predicted 594
8 SASI_Mm02_00334177 predicted 525
9 SASI_Mm02_00334178 predicted 512
10 SASI_Mm02_00334179 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239592 predicted 379
2 SASI_Mm01_00239593 predicted 473
3 SASI_Mm01_00239594 predicted 348
4 SASI_Mm01_00239595 predicted 376
5 SASI_Mm01_00239596 predicted 439
6 SASI_Mm01_00239597 predicted 265
7 SASI_Mm01_00239598 predicted 261
8 SASI_Mm01_00239599 predicted 474
9 SASI_Mm01_00239600 predicted 474
10 SASI_Mm01_00239601 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028654
TEX36 MISSION shRNA Bacterial Glycerol Stock
testis expressed 36
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-433s21c1
Sequence:CCGGTGACTACATCCCATCCAATTTCTCGAGAAATTGGATGGGATGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-740s21c1
Sequence:CCGGCTACCTCATGATTGCTGAAATCTCGAGATTTCAGCAATCATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-703s21c1
Sequence:CCGGTATCCCATCAGGCGGTCATAACTCGAGTTATGACCGCCTGATGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-649s21c1
Sequence:CCGGGGCTTGTGCAGGATCCCTAAACTCGAGTTTAGGGATCCTGCACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-517s21c1
Sequence:CCGGCCGACGATTTCCAAGATATTACTCGAGTAATATCTTGGAAATCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028654
TEX36 MISSION shRNA shRNA Plasmid DNA
testis expressed 36
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-433s21c1
Sequence:CCGGTGACTACATCCCATCCAATTTCTCGAGAAATTGGATGGGATGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-740s21c1
Sequence:CCGGCTACCTCATGATTGCTGAAATCTCGAGATTTCAGCAATCATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-703s21c1
Sequence:CCGGTATCCCATCAGGCGGTCATAACTCGAGTTATGACCGCCTGATGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-649s21c1
Sequence:CCGGGGCTTGTGCAGGATCCCTAAACTCGAGTTTAGGGATCCTGCACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-517s21c1
Sequence:CCGGCCGACGATTTCCAAGATATTACTCGAGTAATATCTTGGAAATCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028654
TEX36 MISSION shRNA Lentiviral Transduction Particles
testis expressed 36
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-433s21c1
Sequence:CCGGTGACTACATCCCATCCAATTTCTCGAGAAATTGGATGGGATGTAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-740s21c1
Sequence:CCGGCTACCTCATGATTGCTGAAATCTCGAGATTTCAGCAATCATGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-703s21c1
Sequence:CCGGTATCCCATCAGGCGGTCATAACTCGAGTTATGACCGCCTGATGGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-649s21c1
Sequence:CCGGGGCTTGTGCAGGATCCCTAAACTCGAGTTTAGGGATCCTGCACAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028654.1-517s21c1
Sequence:CCGGCCGACGATTTCCAAGATATTACTCGAGTAATATCTTGGAAATCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001128202
TEX36 MISSION shRNA Bacterial Glycerol Stock
testis expressed 36
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-446s21c1
Sequence:CCGGAGATAAGAGGCAACATGTTTCCTCGAGGAAACATGTTGCCTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-697s21c1
Sequence:CCGGTTTCTTCACTGGAGTCCTAATCTCGAGATTAGGACTCCAGTGAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128202.1-749s21c1
Sequence:CCGGTACTGGTATTTCATCAGACATCTCGAGATGTCTGATGAAATACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-578s21c1
Sequence:CCGGACGCTTTCCACGATGCTATAACTCGAGTTATAGCATCGTGGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-331s21c1
Sequence:CCGGGGGAGAAGCAAGCAGTGAATACTCGAGTATTCACTGCTTGCTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001128202
TEX36 MISSION shRNA shRNA Plasmid DNA
testis expressed 36
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-446s21c1
Sequence:CCGGAGATAAGAGGCAACATGTTTCCTCGAGGAAACATGTTGCCTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-697s21c1
Sequence:CCGGTTTCTTCACTGGAGTCCTAATCTCGAGATTAGGACTCCAGTGAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128202.1-749s21c1
Sequence:CCGGTACTGGTATTTCATCAGACATCTCGAGATGTCTGATGAAATACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-578s21c1
Sequence:CCGGACGCTTTCCACGATGCTATAACTCGAGTTATAGCATCGTGGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-331s21c1
Sequence:CCGGGGGAGAAGCAAGCAGTGAATACTCGAGTATTCACTGCTTGCTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001128202
TEX36 MISSION shRNA Lentiviral Transduction Particles
testis expressed 36
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-446s21c1
Sequence:CCGGAGATAAGAGGCAACATGTTTCCTCGAGGAAACATGTTGCCTCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-697s21c1
Sequence:CCGGTTTCTTCACTGGAGTCCTAATCTCGAGATTAGGACTCCAGTGAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001128202.1-749s21c1
Sequence:CCGGTACTGGTATTTCATCAGACATCTCGAGATGTCTGATGAAATACCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-578s21c1
Sequence:CCGGACGCTTTCCACGATGCTATAACTCGAGTTATAGCATCGTGGAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001128202.1-331s21c1
Sequence:CCGGGGGAGAAGCAAGCAGTGAATACTCGAGTATTCACTGCTTGCTTCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks