EMAIL THIS PAGE TO A FRIEND

TEX37

testis expressed 37

Synonyms: C2orf51 TSC21
UniProtKB ID: Q96LM6
Gene ID:
Mouse(74221) testis expressed 37
Rat(500197) testis expressed 37
domestic cat(101099291) testis expressed 37
dog(611968) testis expressed 37
cow(616833) chromosome 11 open reading frame, human C2orf51
sheep(101109784) testis expressed 37
domestic guinea pig(100724372) testis expressed 37
naked mole-rat(101713916) testis expressed 37
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152670 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139311 MISSION® esiRNA esiRNA human C2orf51 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152670 Rosetta Predictions human pricing
NM_001109240 Rosetta Predictions rat pricing
NM_028825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117678 predicted 198
2 SASI_Hs01_00117679 predicted 263
3 SASI_Hs01_00117681 predicted 328
4 SASI_Hs02_00366558 predicted 572
5 SASI_Hs01_00117682 predicted 205
6 SASI_Hs01_00117683 predicted 276
7 SASI_Hs01_00117684 predicted 388
8 SASI_Hs01_00117685 predicted 204
9 SASI_Hs01_00117686 predicted 273
10 SASI_Hs01_00117687 predicted 254
11 SASI_Hs01_00117680 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246464 predicted 366
2 SASI_Rn02_00246465 predicted 357
3 SASI_Rn02_00246466 predicted 508
4 SASI_Rn02_00246467 predicted 423
5 SASI_Rn02_00246468 predicted 395
6 SASI_Rn02_00246469 predicted 230
7 SASI_Rn02_00246470 predicted 282
8 SASI_Rn02_00246471 predicted 555
9 SASI_Rn02_00246472 predicted 555
10 SASI_Rn02_00246473 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035248 predicted 284
2 SASI_Mm01_00035249 predicted 376
3 SASI_Mm01_00035250 predicted 355
4 SASI_Mm02_00334451 predicted 399
5 SASI_Mm01_00035252 predicted 372
6 SASI_Mm01_00035253 predicted 518
7 SASI_Mm01_00035254 predicted 559
8 SASI_Mm01_00035255 predicted 454
9 SASI_Mm01_00035256 predicted 346
10 SASI_Mm01_00035257 predicted 351
11 SASI_Mm01_00035251 predicted 432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028825
TEX37 MISSION shRNA Bacterial Glycerol Stock
testis expressed 37
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-393s21c1
Sequence:CCGGTTTACCACCACCTGCCATTATCTCGAGATAATGGCAGGTGGTGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028825.2-636s21c1
Sequence:CCGGTGTGAGAATACCCGCTGTTTCCTCGAGGAAACAGCGGGTATTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-167s21c1
Sequence:CCGGGCCCTTTGGGAAGTACAAATACTCGAGTATTTGTACTTCCCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-116s21c1
Sequence:CCGGGAACCACGTGGACCTAGATATCTCGAGATATCTAGGTCCACGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-145s21c1
Sequence:CCGGGCTCATACATGGTGGACTATACTCGAGTATAGTCCACCATGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028825.1-146s1c1
Sequence:CCGGGCTCATACATGGTGGACTATACTCGAGTATAGTCCACCATGTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028825.1-407s1c1
Sequence:CCGGGCCATTATGCTTACCCAGCATCTCGAGATGCTGGGTAAGCATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028825
TEX37 MISSION shRNA shRNA Plasmid DNA
testis expressed 37
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-393s21c1
Sequence:CCGGTTTACCACCACCTGCCATTATCTCGAGATAATGGCAGGTGGTGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028825.2-636s21c1
Sequence:CCGGTGTGAGAATACCCGCTGTTTCCTCGAGGAAACAGCGGGTATTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-167s21c1
Sequence:CCGGGCCCTTTGGGAAGTACAAATACTCGAGTATTTGTACTTCCCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-116s21c1
Sequence:CCGGGAACCACGTGGACCTAGATATCTCGAGATATCTAGGTCCACGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-145s21c1
Sequence:CCGGGCTCATACATGGTGGACTATACTCGAGTATAGTCCACCATGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028825.1-146s1c1
Sequence:CCGGGCTCATACATGGTGGACTATACTCGAGTATAGTCCACCATGTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028825.1-407s1c1
Sequence:CCGGGCCATTATGCTTACCCAGCATCTCGAGATGCTGGGTAAGCATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028825
TEX37 MISSION shRNA Lentiviral Transduction Particles
testis expressed 37
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-393s21c1
Sequence:CCGGTTTACCACCACCTGCCATTATCTCGAGATAATGGCAGGTGGTGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028825.2-636s21c1
Sequence:CCGGTGTGAGAATACCCGCTGTTTCCTCGAGGAAACAGCGGGTATTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-167s21c1
Sequence:CCGGGCCCTTTGGGAAGTACAAATACTCGAGTATTTGTACTTCCCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-116s21c1
Sequence:CCGGGAACCACGTGGACCTAGATATCTCGAGATATCTAGGTCCACGTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028825.2-145s21c1
Sequence:CCGGGCTCATACATGGTGGACTATACTCGAGTATAGTCCACCATGTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028825.1-146s1c1
Sequence:CCGGGCTCATACATGGTGGACTATACTCGAGTATAGTCCACCATGTATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028825.1-407s1c1
Sequence:CCGGGCCATTATGCTTACCCAGCATCTCGAGATGCTGGGTAAGCATAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152670
TEX37 MISSION shRNA Bacterial Glycerol Stock
testis expressed 37
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-338s1c1
Sequence:CCGGGATGGGTACCCTGCTTTCAAACTCGAGTTTGAAAGCAGGGTACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-460s1c1
Sequence:CCGGCCATTTCACATATCCAGCTTCCTCGAGGAAGCTGGATATGTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-451s1c1
Sequence:CCGGCAGCACCTGCCATTTCACATACTCGAGTATGTGAAATGGCAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-459s1c1
Sequence:CCGGGCCATTTCACATATCCAGCTTCTCGAGAAGCTGGATATGTGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-229s1c1
Sequence:CCGGGAAGCACAAATACTCCAGGGTCTCGAGACCCTGGAGTATTTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152670
TEX37 MISSION shRNA shRNA Plasmid DNA
testis expressed 37
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-338s1c1
Sequence:CCGGGATGGGTACCCTGCTTTCAAACTCGAGTTTGAAAGCAGGGTACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-460s1c1
Sequence:CCGGCCATTTCACATATCCAGCTTCCTCGAGGAAGCTGGATATGTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-451s1c1
Sequence:CCGGCAGCACCTGCCATTTCACATACTCGAGTATGTGAAATGGCAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-459s1c1
Sequence:CCGGGCCATTTCACATATCCAGCTTCTCGAGAAGCTGGATATGTGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-229s1c1
Sequence:CCGGGAAGCACAAATACTCCAGGGTCTCGAGACCCTGGAGTATTTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152670
TEX37 MISSION shRNA Lentiviral Transduction Particles
testis expressed 37
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-338s1c1
Sequence:CCGGGATGGGTACCCTGCTTTCAAACTCGAGTTTGAAAGCAGGGTACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-460s1c1
Sequence:CCGGCCATTTCACATATCCAGCTTCCTCGAGGAAGCTGGATATGTGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-451s1c1
Sequence:CCGGCAGCACCTGCCATTTCACATACTCGAGTATGTGAAATGGCAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163024    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-459s1c1
Sequence:CCGGGCCATTTCACATATCCAGCTTCTCGAGAAGCTGGATATGTGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152670.1-229s1c1
Sequence:CCGGGAAGCACAAATACTCCAGGGTCTCGAGACCCTGGAGTATTTGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks