EMAIL THIS PAGE TO A FRIEND

TEX38

testis expressed 38

Synonyms: ATPAF1-AS1 C1orf223 THEG4
UniProtKB ID: Q6PEX7, A1A4F8
Gene ID:
Mouse(75173) testis expressed 38
Rat(690079) testis expressed 38
domestic guinea pig(100730411) testis expressed 38
sheep(101104616) testis expressed 38
domestic cat(101096158) testis expressed 38
dog(100688138) testis expressed 38
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301318 ANTI-C1ORF223 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145474 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070851 MISSION® esiRNA esiRNA targeting mouse 4930544O15Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717622 Rosetta Predictions human pricing
XM_371248 Rosetta Predictions human pricing
XM_941516 Rosetta Predictions human pricing
NM_001109566 Rosetta Predictions rat pricing
XM_485433 Rosetta Predictions mouse pricing
XM_904855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00418379 predicted 381
2 SASI_Hs02_00418380 predicted 448
3 SASI_Hs02_00418381 predicted 274
4 SASI_Hs02_00418382 predicted 338
5 SASI_Hs02_00418383 predicted 201
6 SASI_Hs02_00418384 predicted 341
7 SASI_Hs02_00418385 predicted 381
8 SASI_Hs02_00418386 predicted 237
9 SASI_Hs02_00418387 predicted 333
10 SASI_Hs02_00418388 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298256 predicted 381
2 SASI_Hs01_00298257 predicted 457
3 SASI_Hs01_00298258 predicted 275
4 SASI_Hs01_00298259 predicted 334
5 SASI_Hs02_00479295 predicted 202
6 SASI_Hs01_00298260 predicted 343
7 SASI_Hs01_00298262 predicted 379
8 SASI_Hs01_00298263 predicted 231
9 SASI_Hs01_00298264 predicted 333
10 SASI_Hs02_00479296 predicted 341
11 SASI_Hs01_00298261 predicted 232
12 SASI_Hs01_00298265 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484922 predicted 379
2 SASI_Hs02_00484923 predicted 274
3 SASI_Hs02_00484924 predicted 343
4 SASI_Hs02_00484925 predicted 195
5 SASI_Hs02_00484926 predicted 342
6 SASI_Hs02_00484927 predicted 382
7 SASI_Hs02_00484928 predicted 240
8 SASI_Hs02_00484929 predicted 456
9 SASI_Hs02_00484930 predicted 328
10 SASI_Hs02_00484931 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249651 predicted 214
2 SASI_Rn02_00249652 predicted 208
3 SASI_Rn02_00249653 predicted 532
4 SASI_Rn02_00249654 predicted 290
5 SASI_Rn02_00249655 predicted 532
6 SASI_Rn02_00249656 predicted 541
7 SASI_Rn02_00249657 predicted 217
8 SASI_Rn02_00249658 predicted 266
9 SASI_Rn02_00249659 predicted 278
10 SASI_Rn02_00249660 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237240 predicted 228
2 SASI_Mm01_00237241 predicted 214
3 SASI_Mm01_00237242 predicted 285
4 SASI_Mm01_00237243 predicted 369
5 SASI_Mm01_00237244 predicted 230
6 SASI_Mm01_00237245 predicted 221
7 SASI_Mm01_00237246 predicted 580
8 SASI_Mm02_00426661 predicted 280
9 SASI_Mm01_00237247 predicted 220
10 SASI_Mm01_00237248 predicted 359
11 SASI_Mm01_00237249 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431297 predicted 223
2 SASI_Mm02_00431298 predicted 216
3 SASI_Mm02_00431299 predicted 369
4 SASI_Mm02_00431300 predicted 330
5 SASI_Mm02_00431301 predicted 216
6 SASI_Mm02_00431302 predicted 583
7 SASI_Mm02_00431303 predicted 328
8 SASI_Mm02_00431304 predicted 556
9 SASI_Mm02_00431305 predicted 363
10 SASI_Mm02_00431306 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145474
TEX38 MISSION shRNA Bacterial Glycerol Stock
testis expressed 38
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-296s21c1
Sequence:CCGGCCCATTGTTGTACTGGATTAACTCGAGTTAATCCAGTACAACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-267s21c1
Sequence:CCGGGTGATGAGAGCTGCCACATTCCTCGAGGAATGTGGCAGCTCTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-145s21c1
Sequence:CCGGTGTGGGTCTCATTGTACTTTGCTCGAGCAAAGTACAATGAGACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-538s21c1
Sequence:CCGGCATTCCCACTTCCCATCTTTCCTCGAGGAAAGATGGGAAGTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-193s21c1
Sequence:CCGGCTGGAGGGTGCATTATCTTTCCTCGAGGAAAGATAATGCACCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145474
TEX38 MISSION shRNA shRNA Plasmid DNA
testis expressed 38
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-296s21c1
Sequence:CCGGCCCATTGTTGTACTGGATTAACTCGAGTTAATCCAGTACAACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-267s21c1
Sequence:CCGGGTGATGAGAGCTGCCACATTCCTCGAGGAATGTGGCAGCTCTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-145s21c1
Sequence:CCGGTGTGGGTCTCATTGTACTTTGCTCGAGCAAAGTACAATGAGACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-538s21c1
Sequence:CCGGCATTCCCACTTCCCATCTTTCCTCGAGGAAAGATGGGAAGTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-193s21c1
Sequence:CCGGCTGGAGGGTGCATTATCTTTCCTCGAGGAAAGATAATGCACCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145474
TEX38 MISSION shRNA Lentiviral Transduction Particles
testis expressed 38
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-296s21c1
Sequence:CCGGCCCATTGTTGTACTGGATTAACTCGAGTTAATCCAGTACAACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-267s21c1
Sequence:CCGGGTGATGAGAGCTGCCACATTCCTCGAGGAATGTGGCAGCTCTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-145s21c1
Sequence:CCGGTGTGGGTCTCATTGTACTTTGCTCGAGCAAAGTACAATGAGACCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-538s21c1
Sequence:CCGGCATTCCCACTTCCCATCTTTCCTCGAGGAAAGATGGGAAGTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145474.1-193s21c1
Sequence:CCGGCTGGAGGGTGCATTATCTTTCCTCGAGGAAAGATAATGCACCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks