EMAIL THIS PAGE TO A FRIEND

TEX40

testis expressed 40

Synonyms: C11orf20
UniProtKB ID: Q9NTU4
Gene ID:
Mouse(67077) testis expressed 40
Rat(100362120) testis expressed 40
cow(100847812) testis expressed 40
naked mole-rat(101724210) testis expressed 40
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039496 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025953 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025953 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025953 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039496 Rosetta Predictions human pricing
NM_001039494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308537 predicted 374
2 SASI_Hs02_00308538 predicted 501
3 SASI_Hs02_00308539 predicted 307
4 SASI_Hs02_00308540 predicted 501
5 SASI_Hs02_00308541 predicted 458
6 SASI_Hs02_00308542 predicted 312
7 SASI_Hs02_00308543 predicted 481
8 SASI_Hs02_00308544 predicted 370
9 SASI_Hs02_00308545 predicted 503
10 SASI_Hs02_00308546 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147924 predicted 505
2 SASI_Mm01_00147925 predicted 283
3 SASI_Mm01_00147926 predicted 403
4 SASI_Mm01_00147927 predicted 237
5 SASI_Mm01_00147929 predicted 480
6 SASI_Mm01_00147930 predicted 256
7 SASI_Mm02_00290076 predicted 251
8 SASI_Mm02_00290077 predicted 400
9 SASI_Mm02_00290078 predicted 399
10 SASI_Mm02_00290079 predicted 424
11 SASI_Mm01_00147928 predicted 555
12 SASI_Mm01_00147931 predicted 222
13 SASI_Mm01_00147932 predicted 540
14 SASI_Mm01_00147933 predicted 553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039496
TEX40 MISSION shRNA Bacterial Glycerol Stock
testis expressed 40
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-127s21c1
Sequence:CCGGTGTCCCAGGCACAGCTGAACACTCGAGTGTTCAGCTGTGCCTGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-316s21c1
Sequence:CCGGGCAGCTCCATGGAAATCAATCCTCGAGGATTGATTTCCATGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-82s21c1
Sequence:CCGGAGAGCGTGCATAGCGACACTCCTCGAGGAGTGTCGCTATGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-344s21c1
Sequence:CCGGGAAGGACACTGCATCCCAGATCTCGAGATCTGGGATGCAGTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-48s21c1
Sequence:CCGGCTCAAGTCTTCCGACCGCCAACTCGAGTTGGCGGTCGGAAGACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039496
TEX40 MISSION shRNA shRNA Plasmid DNA
testis expressed 40
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-127s21c1
Sequence:CCGGTGTCCCAGGCACAGCTGAACACTCGAGTGTTCAGCTGTGCCTGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-316s21c1
Sequence:CCGGGCAGCTCCATGGAAATCAATCCTCGAGGATTGATTTCCATGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-82s21c1
Sequence:CCGGAGAGCGTGCATAGCGACACTCCTCGAGGAGTGTCGCTATGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-344s21c1
Sequence:CCGGGAAGGACACTGCATCCCAGATCTCGAGATCTGGGATGCAGTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-48s21c1
Sequence:CCGGCTCAAGTCTTCCGACCGCCAACTCGAGTTGGCGGTCGGAAGACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039496
TEX40 MISSION shRNA Lentiviral Transduction Particles
testis expressed 40
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-127s21c1
Sequence:CCGGTGTCCCAGGCACAGCTGAACACTCGAGTGTTCAGCTGTGCCTGGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-316s21c1
Sequence:CCGGGCAGCTCCATGGAAATCAATCCTCGAGGATTGATTTCCATGGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-82s21c1
Sequence:CCGGAGAGCGTGCATAGCGACACTCCTCGAGGAGTGTCGCTATGCACGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-344s21c1
Sequence:CCGGGAAGGACACTGCATCCCAGATCTCGAGATCTGGGATGCAGTGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039496.1-48s21c1
Sequence:CCGGCTCAAGTCTTCCGACCGCCAACTCGAGTTGGCGGTCGGAAGACTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025953
TEX40 MISSION shRNA Bacterial Glycerol Stock
testis expressed 40
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-383s1c1
Sequence:CCGGCGAAGAATCTGAGACCTCCTTCTCGAGAAGGAGGTCTCAGATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-516s1c1
Sequence:CCGGGAAGTTCTGGATATTCTCAAACTCGAGTTTGAGAATATCCAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-269s1c1
Sequence:CCGGCCAGACCATTTCTATTAGGGACTCGAGTCCCTAATAGAAATGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-384s1c1
Sequence:CCGGGAAGAATCTGAGACCTCCTTACTCGAGTAAGGAGGTCTCAGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-236s1c1
Sequence:CCGGCAAATCTGTAAGAAACAGGATCTCGAGATCCTGTTTCTTACAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-510s1c1
Sequence:CCGGGAGACTGAAGTTCTGGATATTCTCGAGAATATCCAGAACTTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-235s1c1
Sequence:CCGGGCAAATCTGTAAGAAACAGGACTCGAGTCCTGTTTCTTACAGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-409s1c1
Sequence:CCGGCGTCTACTTCAGAATCACTAACTCGAGTTAGTGATTCTGAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-420s1c1
Sequence:CCGGGAATCACTAATATTCAGCCTACTCGAGTAGGCTGAATATTAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-410s1c1
Sequence:CCGGGTCTACTTCAGAATCACTAATCTCGAGATTAGTGATTCTGAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025953
TEX40 MISSION shRNA shRNA Plasmid DNA
testis expressed 40
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-383s1c1
Sequence:CCGGCGAAGAATCTGAGACCTCCTTCTCGAGAAGGAGGTCTCAGATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-516s1c1
Sequence:CCGGGAAGTTCTGGATATTCTCAAACTCGAGTTTGAGAATATCCAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-269s1c1
Sequence:CCGGCCAGACCATTTCTATTAGGGACTCGAGTCCCTAATAGAAATGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-384s1c1
Sequence:CCGGGAAGAATCTGAGACCTCCTTACTCGAGTAAGGAGGTCTCAGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-236s1c1
Sequence:CCGGCAAATCTGTAAGAAACAGGATCTCGAGATCCTGTTTCTTACAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-510s1c1
Sequence:CCGGGAGACTGAAGTTCTGGATATTCTCGAGAATATCCAGAACTTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-235s1c1
Sequence:CCGGGCAAATCTGTAAGAAACAGGACTCGAGTCCTGTTTCTTACAGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-409s1c1
Sequence:CCGGCGTCTACTTCAGAATCACTAACTCGAGTTAGTGATTCTGAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-420s1c1
Sequence:CCGGGAATCACTAATATTCAGCCTACTCGAGTAGGCTGAATATTAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-410s1c1
Sequence:CCGGGTCTACTTCAGAATCACTAATCTCGAGATTAGTGATTCTGAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025953
TEX40 MISSION shRNA Lentiviral Transduction Particles
testis expressed 40
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-383s1c1
Sequence:CCGGCGAAGAATCTGAGACCTCCTTCTCGAGAAGGAGGTCTCAGATTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-516s1c1
Sequence:CCGGGAAGTTCTGGATATTCTCAAACTCGAGTTTGAGAATATCCAGAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-269s1c1
Sequence:CCGGCCAGACCATTTCTATTAGGGACTCGAGTCCCTAATAGAAATGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-384s1c1
Sequence:CCGGGAAGAATCTGAGACCTCCTTACTCGAGTAAGGAGGTCTCAGATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-236s1c1
Sequence:CCGGCAAATCTGTAAGAAACAGGATCTCGAGATCCTGTTTCTTACAGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-510s1c1
Sequence:CCGGGAGACTGAAGTTCTGGATATTCTCGAGAATATCCAGAACTTCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-235s1c1
Sequence:CCGGGCAAATCTGTAAGAAACAGGACTCGAGTCCTGTTTCTTACAGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-409s1c1
Sequence:CCGGCGTCTACTTCAGAATCACTAACTCGAGTTAGTGATTCTGAAGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025953.1-420s1c1
Sequence:CCGGGAATCACTAATATTCAGCCTACTCGAGTAGGCTGAATATTAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025953.1-410s1c1
Sequence:CCGGGTCTACTTCAGAATCACTAATCTCGAGATTAGTGATTCTGAAGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks