EMAIL THIS PAGE TO A FRIEND

TEX9

testis expressed 9

UniProtKB ID: Q8N6V9
Gene ID:
Mouse(21778) testis expressed gene 9
Rat(300822) testis expressed 9
cow(518432) testis expressed 9
sheep(101103983) testis expressed 9
naked mole-rat(101719639) testis expressed 9
domestic guinea pig(100715936) testis expressed 9
Zebrafish(553441) testis expressed 9
Horse(100054636) testis expressed 9
domestic cat(101089521) testis expressed 9
dog(487572) testis expressed 9
chicken(425342) testis expressed 9
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009359 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009359 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009359 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198524 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036121 MISSION® esiRNA esiRNA human TEX9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198524 Rosetta Predictions human pricing
XM_001054229 Rosetta Predictions rat pricing
XM_217200 Rosetta Predictions rat pricing
NM_009359 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160918 predicted 1043
2 SASI_Hs01_00160919 predicted 571
3 SASI_Hs01_00160920 predicted 614
4 SASI_Hs02_00372102 predicted 437
5 SASI_Hs01_00160922 predicted 934
6 SASI_Hs01_00160923 predicted 921
7 SASI_Hs01_00160925 predicted 807
8 SASI_Hs01_00160926 predicted 785
9 SASI_Hs01_00160927 predicted 303
10 SASI_Hs02_00372103 predicted 204
11 SASI_Hs01_00160921 predicted 631
12 SASI_Hs01_00160924 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275153 predicted 1067
2 SASI_Rn02_00275154 predicted 1023
3 SASI_Rn02_00275155 predicted 1100
4 SASI_Rn02_00275156 predicted 932
5 SASI_Rn02_00275157 predicted 293
6 SASI_Rn02_00275158 predicted 1216
7 SASI_Rn02_00275159 predicted 777
8 SASI_Rn02_00275160 predicted 328
9 SASI_Rn02_00275161 predicted 676
10 SASI_Rn02_00275162 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141586 predicted 1080
2 SASI_Rn01_00141587 predicted 932
3 SASI_Rn01_00141588 predicted 297
4 SASI_Rn01_00141589 predicted 492
5 SASI_Rn01_00141590 predicted 783
6 SASI_Rn01_00141591 predicted 334
7 SASI_Rn01_00141592 predicted 679
8 SASI_Rn01_00141593 predicted 372
9 SASI_Rn01_00141594 predicted 1093
10 SASI_Rn01_00141595 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047875 predicted 886
2 SASI_Mm01_00047876 predicted 634
3 SASI_Mm02_00315958 predicted 630
4 SASI_Mm01_00047877 predicted 205
5 SASI_Mm01_00047878 predicted 802
6 SASI_Mm01_00047879 predicted 286
7 SASI_Mm01_00047881 predicted 315
8 SASI_Mm01_00047882 predicted 372
9 SASI_Mm02_00315959 predicted 658
10 SASI_Mm02_00315960 predicted 877
11 SASI_Mm01_00047874 predicted 1319
12 SASI_Mm01_00047880 predicted 1196
13 SASI_Mm01_00047883 predicted 1182
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009359
TEX9 MISSION shRNA Bacterial Glycerol Stock
testis expressed 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009359.1-977s1c1
Sequence:CCGGCCCAGCAATCCCAAATAGAAACTCGAGTTTCTATTTGGGATTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009359.1-684s1c1
Sequence:CCGGCCCAGACGATTTCTCAGACTTCTCGAGAAGTCTGAGAAATCGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009359.1-1839s1c1
Sequence:CCGGGCAGTTGAAATTGATTGACATCTCGAGATGTCAATCAATTTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-156s21c1
Sequence:CCGGGACAAGCTGAGGAAGTAATAACTCGAGTTATTACTTCCTCAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-806s21c1
Sequence:CCGGTCATCAGTAGAACGGGAATTACTCGAGTAATTCCCGTTCTACTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-100s21c1
Sequence:CCGGACAAGAGTACAAGCGTTTAAACTCGAGTTTAAACGCTTGTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-424s21c1
Sequence:CCGGTGTGGCCATCCCAGACGATTTCTCGAGAAATCGTCTGGGATGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-560s21c1
Sequence:CCGGACAGAGGCTCAGATCCGATTTCTCGAGAAATCGGATCTGAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009359
TEX9 MISSION shRNA shRNA Plasmid DNA
testis expressed 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009359.1-977s1c1
Sequence:CCGGCCCAGCAATCCCAAATAGAAACTCGAGTTTCTATTTGGGATTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009359.1-684s1c1
Sequence:CCGGCCCAGACGATTTCTCAGACTTCTCGAGAAGTCTGAGAAATCGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009359.1-1839s1c1
Sequence:CCGGGCAGTTGAAATTGATTGACATCTCGAGATGTCAATCAATTTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-156s21c1
Sequence:CCGGGACAAGCTGAGGAAGTAATAACTCGAGTTATTACTTCCTCAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-806s21c1
Sequence:CCGGTCATCAGTAGAACGGGAATTACTCGAGTAATTCCCGTTCTACTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-100s21c1
Sequence:CCGGACAAGAGTACAAGCGTTTAAACTCGAGTTTAAACGCTTGTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-424s21c1
Sequence:CCGGTGTGGCCATCCCAGACGATTTCTCGAGAAATCGTCTGGGATGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-560s21c1
Sequence:CCGGACAGAGGCTCAGATCCGATTTCTCGAGAAATCGGATCTGAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009359
TEX9 MISSION shRNA Lentiviral Transduction Particles
testis expressed 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009359.1-977s1c1
Sequence:CCGGCCCAGCAATCCCAAATAGAAACTCGAGTTTCTATTTGGGATTGCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009359.1-684s1c1
Sequence:CCGGCCCAGACGATTTCTCAGACTTCTCGAGAAGTCTGAGAAATCGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009359.1-1839s1c1
Sequence:CCGGGCAGTTGAAATTGATTGACATCTCGAGATGTCAATCAATTTCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-156s21c1
Sequence:CCGGGACAAGCTGAGGAAGTAATAACTCGAGTTATTACTTCCTCAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-806s21c1
Sequence:CCGGTCATCAGTAGAACGGGAATTACTCGAGTAATTCCCGTTCTACTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-100s21c1
Sequence:CCGGACAAGAGTACAAGCGTTTAAACTCGAGTTTAAACGCTTGTACTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-424s21c1
Sequence:CCGGTGTGGCCATCCCAGACGATTTCTCGAGAAATCGTCTGGGATGGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009359.3-560s21c1
Sequence:CCGGACAGAGGCTCAGATCCGATTTCTCGAGAAATCGGATCTGAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198524
VALIDATED
TEX9 MISSION shRNA Bacterial Glycerol Stock
testis expressed 9
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198524.1-1262s1c1
Sequence:CCGGCCTAGTCAAGTCCTAGTAGTACTCGAGTACTACTAGGACTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_198524.1-450s1c1
Sequence:CCGGCCAGAGGATTTCTCAGACTTTCTCGAGAAAGTCTGAGAAATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198524.1-606s1c1
Sequence:CCGGCTCCATGTTATGCAGGAGGAACTCGAGTTCCTCCTGCATAACATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198524.1-111s1c1
Sequence:CCGGGAGGAAGAATATAAGCGTTTACTCGAGTAAACGCTTATATTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198524.1-608s1c1
Sequence:CCGGCCATGTTATGCAGGAGGAATTCTCGAGAATTCCTCCTGCATAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198524.1-1250s21c1
Sequence:CCGGACTTGCATGACACCTAGTCAACTCGAGTTGACTAGGTGTCATGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198524.1-1276s21c1
Sequence:CCGGAGTAGTATTCGACTTTCATTTCTCGAGAAATGAAAGTCGAATACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-1055s21c1
Sequence:CCGGAGGGTTCAAGAAACAGTTAAACTCGAGTTTAACTGTTTCTTGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-1179s21c1
Sequence:CCGGTAAGTGATCTACTTCAGTTAGCTCGAGCTAACTGAAGTAGATCACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-636s21c1
Sequence:CCGGGTTGTATGTGAATGCAATAAACTCGAGTTTATTGCATTCACATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-203s21c1
Sequence:CCGGAGTACGATCTAGGCCTGTTTCCTCGAGGAAACAGGCCTAGATCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-337s21c1
Sequence:CCGGATCCTGTAAACAAGGTTCAAACTCGAGTTTGAACCTTGTTTACAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-812s21c1
Sequence:CCGGACAGTTGTCTTCAGTAGAAAGCTCGAGCTTTCTACTGAAGACAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-513s21c1
Sequence:CCGGGAAGAAGGCTTACCTGAATATCTCGAGATATTCAGGTAAGCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-287s21c1
Sequence:CCGGAGGGATAGTTCATCTTCATTCCTCGAGGAATGAAGATGAACTATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-961s21c1
Sequence:CCGGATAACAAGGACATAGCAAATGCTCGAGCATTTGCTATGTCCTTGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198524
VALIDATED
TEX9 MISSION shRNA shRNA Plasmid DNA
testis expressed 9
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198524.1-1262s1c1
Sequence:CCGGCCTAGTCAAGTCCTAGTAGTACTCGAGTACTACTAGGACTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_198524.1-450s1c1
Sequence:CCGGCCAGAGGATTTCTCAGACTTTCTCGAGAAAGTCTGAGAAATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198524.1-606s1c1
Sequence:CCGGCTCCATGTTATGCAGGAGGAACTCGAGTTCCTCCTGCATAACATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198524.1-111s1c1
Sequence:CCGGGAGGAAGAATATAAGCGTTTACTCGAGTAAACGCTTATATTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198524.1-608s1c1
Sequence:CCGGCCATGTTATGCAGGAGGAATTCTCGAGAATTCCTCCTGCATAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198524.1-1250s21c1
Sequence:CCGGACTTGCATGACACCTAGTCAACTCGAGTTGACTAGGTGTCATGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198524.1-1276s21c1
Sequence:CCGGAGTAGTATTCGACTTTCATTTCTCGAGAAATGAAAGTCGAATACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-1055s21c1
Sequence:CCGGAGGGTTCAAGAAACAGTTAAACTCGAGTTTAACTGTTTCTTGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-1179s21c1
Sequence:CCGGTAAGTGATCTACTTCAGTTAGCTCGAGCTAACTGAAGTAGATCACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-636s21c1
Sequence:CCGGGTTGTATGTGAATGCAATAAACTCGAGTTTATTGCATTCACATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-203s21c1
Sequence:CCGGAGTACGATCTAGGCCTGTTTCCTCGAGGAAACAGGCCTAGATCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-337s21c1
Sequence:CCGGATCCTGTAAACAAGGTTCAAACTCGAGTTTGAACCTTGTTTACAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-812s21c1
Sequence:CCGGACAGTTGTCTTCAGTAGAAAGCTCGAGCTTTCTACTGAAGACAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-513s21c1
Sequence:CCGGGAAGAAGGCTTACCTGAATATCTCGAGATATTCAGGTAAGCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-287s21c1
Sequence:CCGGAGGGATAGTTCATCTTCATTCCTCGAGGAATGAAGATGAACTATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-961s21c1
Sequence:CCGGATAACAAGGACATAGCAAATGCTCGAGCATTTGCTATGTCCTTGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198524
VALIDATED
TEX9 MISSION shRNA Lentiviral Transduction Particles
testis expressed 9
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198524.1-1262s1c1
Sequence:CCGGCCTAGTCAAGTCCTAGTAGTACTCGAGTACTACTAGGACTTGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_198524.1-450s1c1
Sequence:CCGGCCAGAGGATTTCTCAGACTTTCTCGAGAAAGTCTGAGAAATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198524.1-606s1c1
Sequence:CCGGCTCCATGTTATGCAGGAGGAACTCGAGTTCCTCCTGCATAACATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198524.1-111s1c1
Sequence:CCGGGAGGAAGAATATAAGCGTTTACTCGAGTAAACGCTTATATTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198524.1-608s1c1
Sequence:CCGGCCATGTTATGCAGGAGGAATTCTCGAGAATTCCTCCTGCATAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429985    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198524.1-1250s21c1
Sequence:CCGGACTTGCATGACACCTAGTCAACTCGAGTTGACTAGGTGTCATGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198524.1-1276s21c1
Sequence:CCGGAGTAGTATTCGACTTTCATTTCTCGAGAAATGAAAGTCGAATACTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-1055s21c1
Sequence:CCGGAGGGTTCAAGAAACAGTTAAACTCGAGTTTAACTGTTTCTTGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-1179s21c1
Sequence:CCGGTAAGTGATCTACTTCAGTTAGCTCGAGCTAACTGAAGTAGATCACTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-636s21c1
Sequence:CCGGGTTGTATGTGAATGCAATAAACTCGAGTTTATTGCATTCACATACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-203s21c1
Sequence:CCGGAGTACGATCTAGGCCTGTTTCCTCGAGGAAACAGGCCTAGATCGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-337s21c1
Sequence:CCGGATCCTGTAAACAAGGTTCAAACTCGAGTTTGAACCTTGTTTACAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-812s21c1
Sequence:CCGGACAGTTGTCTTCAGTAGAAAGCTCGAGCTTTCTACTGAAGACAACTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-513s21c1
Sequence:CCGGGAAGAAGGCTTACCTGAATATCTCGAGATATTCAGGTAAGCCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-287s21c1
Sequence:CCGGAGGGATAGTTCATCTTCATTCCTCGAGGAATGAAGATGAACTATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198524.1-961s21c1
Sequence:CCGGATAACAAGGACATAGCAAATGCTCGAGCATTTGCTATGTCCTTGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks