EMAIL THIS PAGE TO A FRIEND

TF

transferrin

Synonyms: PRO1557 PRO2086 TFQTL1
UniProtKB ID: P02787, O43890, Q1HBA5, Q9NQB8, Q9UHV0
Gene ID:
Human(7018) Summary: This gene encodes a glycoprotein with an approximate molecular weight of 76.5 kDa. It is thought to have been created as a result of an ancient gene duplication event that led to generation of homologous C and N-terminal domains each of which binds one ion of ferric iron. The function of this protein is to transport iron from the intestine, reticuloendothelial system, and liver parenchymal cells to all proliferating cells in the body. This protein may also have a physiologic role as granulocyte/pollen-binding protein (GPBP) involved in the removal of certain organic matter and allergens from serum. [provided by RefSeq, Sep 2009]
Mouse(21779) tufted
Rat(24825) transferrin
chicken(396241) transferrin (ovotransferrin)
Horse(100034176) transferrin
dog(477072) transferrin
cow(280705) transferrin
sheep(443000) transferrin
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
T2252 apo-Transferrin human ≥95% protein basis (biuret) human pricing
T2036 apo-Transferrin human powder, BioReagent, suitable for cell culture, ≥98% (agarose gel electrophoresis) human pricing
T4382 apo-Transferrin human powder, ≥98% (agarose gel electrophoresis) human pricing
T5391 apo-Transferrin human γ-irradiated, powder, BioXtra, suitable for cell culture, ≥98% human pricing
T0665 holo-Transferrin human powder, BioReagent, suitable for cell culture, ≥97% human pricing
T4132 holo-Transferrin human ≥98% human pricing
APREST84506 PrEST Antigen TF Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
APREST84507 PrEST Antigen TF Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST23181 SILuPrEST TF SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22570 SILuPrEST TRFE SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST22571 SILuPrEST TRFE SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
SRP6512 Transferrin (HOLO) from human plasma ≥95% (SDS-PAGE) human pricing
90190 Transferrin from human blood plasma ≥95% (GE) human pricing
T3309 Transferrin human ≥98% human pricing
T8158 Transferrin human powder, BioReagent, suitable for cell culture human pricing
SRP6472 Transferrin human recombinant, expressed in HEK 293 cells, ≥95% (SDS-PAGE) human pricing
T3915 Transferrin-biotin labeled human lyophilized powder containing sodium citrate human pricing
T6013 apo-Transferrin from rat ~98% rat pricing
SRP6511 Apotransferrin from rat plasma ≥98% (SDS-PAGE) rat pricing
SRP6513 Transferrin from rat plasma ≥98% (SDS-PAGE) rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB0747 Human TF / Serotransferrin ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001063 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144111 MISSION® esiRNA esiRNA human TF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001063 Rosetta Predictions human pricing
NM_001013110 Rosetta Predictions rat pricing
XM_579389 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224553 predicted 501
2 SASI_Hs01_00224554 predicted 1660
3 SASI_Hs01_00224555 predicted 1346
4 SASI_Hs01_00224556 predicted 382
5 SASI_Hs01_00224557 predicted 1240
6 SASI_Hs01_00224558 predicted 1935
7 SASI_Hs01_00224559 predicted 551
8 SASI_Hs01_00224560 predicted 713
9 SASI_Hs01_00224561 predicted 1880
10 SASI_Hs01_00224562 predicted 1774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102826 predicted 1312
2 SASI_Rn01_00102827 predicted 683
3 SASI_Rn01_00102828 predicted 1404
4 SASI_Rn01_00102829 predicted 1609
5 SASI_Rn01_00102830 predicted 1834
6 SASI_Rn01_00102831 predicted 1644
7 SASI_Rn01_00102832 predicted 1787
8 SASI_Rn02_00200799 predicted 958
9 SASI_Rn01_00102833 predicted 1795
10 SASI_Rn01_00102834 predicted 1343
11 SASI_Rn01_00102835 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579389 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142737 predicted 670
2 SASI_Rn01_00142738 predicted 220
3 SASI_Rn01_00142739 predicted 624
4 SASI_Rn01_00142740 predicted 240
5 SASI_Rn01_00142741 predicted 382
6 SASI_Rn01_00142742 predicted 676
7 SASI_Rn01_00142743 predicted 526
8 SASI_Rn01_00142744 predicted 287
9 SASI_Rn01_00142745 predicted 649
10 SASI_Rn01_00142746 predicted 720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001063
TF MISSION shRNA Bacterial Glycerol Stock
transferrin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001063.3-1625s21c1
Sequence:CCGGTACACCAGAGGCAGGGTATTTCTCGAGAAATACCCTGCCTCTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001063.3-1597s21c1
Sequence:CCGGACTACAATAAGAGCGATAATTCTCGAGAATTATCGCTCTTATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001063.3-2386s21c1
Sequence:CCGGGCACTTTCCGTAGACCTTAAACTCGAGTTTAAGGTCTACGGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-1502s1c1
Sequence:CCGGCCTGCTCTACAATAAGATCAACTCGAGTTGATCTTATTGTAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-531s1c1
Sequence:CCGGCCACGTAAACCTCTTGAGAAACTCGAGTTTCTCAAGAGGTTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-1752s1c1
Sequence:CCGGCCATGGGCTAAGAATCTGAATCTCGAGATTCAGATTCTTAGCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-725s1c1
Sequence:CCGGGCACTCGACTATATTTGAGAACTCGAGTTCTCAAATATAGTCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-1582s1c1
Sequence:CCGGCCAGTCTCTGTAAGCTGTGTACTCGAGTACACAGCTTACAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001063
TF MISSION shRNA shRNA Plasmid DNA
transferrin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001063.3-1625s21c1
Sequence:CCGGTACACCAGAGGCAGGGTATTTCTCGAGAAATACCCTGCCTCTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001063.3-1597s21c1
Sequence:CCGGACTACAATAAGAGCGATAATTCTCGAGAATTATCGCTCTTATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001063.3-2386s21c1
Sequence:CCGGGCACTTTCCGTAGACCTTAAACTCGAGTTTAAGGTCTACGGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-1502s1c1
Sequence:CCGGCCTGCTCTACAATAAGATCAACTCGAGTTGATCTTATTGTAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-531s1c1
Sequence:CCGGCCACGTAAACCTCTTGAGAAACTCGAGTTTCTCAAGAGGTTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-1752s1c1
Sequence:CCGGCCATGGGCTAAGAATCTGAATCTCGAGATTCAGATTCTTAGCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-725s1c1
Sequence:CCGGGCACTCGACTATATTTGAGAACTCGAGTTCTCAAATATAGTCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-1582s1c1
Sequence:CCGGCCAGTCTCTGTAAGCTGTGTACTCGAGTACACAGCTTACAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001063
TF MISSION shRNA Lentiviral Transduction Particles
transferrin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001063.3-1625s21c1
Sequence:CCGGTACACCAGAGGCAGGGTATTTCTCGAGAAATACCCTGCCTCTGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001063.3-1597s21c1
Sequence:CCGGACTACAATAAGAGCGATAATTCTCGAGAATTATCGCTCTTATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001063.3-2386s21c1
Sequence:CCGGGCACTTTCCGTAGACCTTAAACTCGAGTTTAAGGTCTACGGAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-1502s1c1
Sequence:CCGGCCTGCTCTACAATAAGATCAACTCGAGTTGATCTTATTGTAGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-531s1c1
Sequence:CCGGCCACGTAAACCTCTTGAGAAACTCGAGTTTCTCAAGAGGTTTACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-1752s1c1
Sequence:CCGGCCATGGGCTAAGAATCTGAATCTCGAGATTCAGATTCTTAGCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-725s1c1
Sequence:CCGGGCACTCGACTATATTTGAGAACTCGAGTTCTCAAATATAGTCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001063.2-1582s1c1
Sequence:CCGGCCAGTCTCTGTAAGCTGTGTACTCGAGTACACAGCTTACAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks