EMAIL THIS PAGE TO A FRIEND

TFAM

transcription factor A, mitochondrial

Synonyms: MTTF1 MTTFA TCF6 TCF6L1 TCF6L2 TCF6L3
UniProtKB ID: Q00059, A8MRB2, A9QXC6, B5BU05, Q5U0C6
Gene ID:
Human(7019) Summary: This gene encodes a key mitochondrial transcription factor containing two high mobility group motifs. The encoded protein also functions in mitochondrial DNA replication and repair. Sequence polymorphisms in this gene are associated with Alzheimer's and Parkinson's diseases. There are pseudogenes for this gene on chromosomes 6, 7, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(21780) transcription factor A, mitochondrial
Rat(83474) transcription factor A, mitochondrial
fruit fly(42433) mitochondrial transcription factor A
domestic cat(101096672) transcription factor A, mitochondrial
dog(488989) transcription factor A, mitochondrial
chicken(373888) transcription factor A, mitochondrial
Zebrafish(571106) transcription factor A, mitochondrial
naked mole-rat(101698418) transcription factor A, mitochondrial
domestic guinea pig(100735113) transcription factor A, mitochondrial
cow(510059) transcription factor A, mitochondrial
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31400 Anti-TFAM (AB1) antibody produced in rabbit affinity isolated antibody bovine, guinea pig, rabbit, canine, human, mouse, horse, pig
western blot pricing
AV36992 Anti-TFAM (AB2) antibody produced in rabbit affinity isolated antibody rat, mouse, rabbit
western blot pricing
AV36993 Anti-TFAM (AB3) antibody produced in rabbit affinity isolated antibody bovine, rabbit, mouse, rat
immunohistochemistry, western blot pricing
SAB1401382 Anti-TFAM antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1401383 Anti-TFAM antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB2103141 Anti-TFAM antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2103142 Anti-TFAM antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4502947 Anti-TFAM antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
HPA040648 Anti-TFAM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA063684 Anti-TFAM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003201 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003201 Rosetta Predictions human pricing
NM_031326 Rosetta Predictions rat pricing
NM_009360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132204 predicted 266
2 SASI_Hs01_00132205 predicted 279
3 SASI_Hs01_00132206 predicted 913
4 SASI_Hs01_00132207 predicted 809
5 SASI_Hs01_00132208 predicted 312
6 SASI_Hs01_00132209 predicted 924
7 SASI_Hs01_00132210 predicted 339
8 SASI_Hs01_00132211 predicted 908
9 SASI_Hs01_00132212 predicted 906
10 SASI_Hs01_00132213 predicted 916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109966 predicted 571
2 SASI_Rn01_00109967 predicted 694
3 SASI_Rn01_00109968 predicted 640
4 SASI_Rn01_00109969 predicted 254
5 SASI_Rn01_00109970 predicted 888
6 SASI_Rn01_00109972 predicted 197
7 SASI_Rn01_00109975 predicted 820
8 SASI_Rn02_00264542 predicted 700
9 SASI_Rn02_00264543 predicted 618
10 SASI_Rn02_00264544 predicted 927
11 SASI_Rn01_00109971 predicted 308
12 SASI_Rn01_00109973 predicted 716
13 SASI_Rn01_00109974 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100578 predicted 255
2 SASI_Mm01_00100579 predicted 908
3 SASI_Mm01_00100580 predicted 687
4 SASI_Mm01_00100581 predicted 885
5 SASI_Mm01_00100582 predicted 300
6 SASI_Mm01_00100583 predicted 914
7 SASI_Mm01_00100584 predicted 617
8 SASI_Mm01_00100585 predicted 896
9 SASI_Mm01_00100586 predicted 815
10 SASI_Mm01_00100587 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003201
VALIDATED
TFAM MISSION shRNA Bacterial Glycerol Stock
transcription factor A, mitochondrial
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-826s1c1
Sequence:CCGGCGTCGCACAATAAAGAAACAACTCGAGTTGTTTCTTTATTGTGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-1637s1c1
Sequence:CCGGCGTGAGTATATTGATCCAGAACTCGAGTTCTGGATCAATATACTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-476s1c1
Sequence:CCGGGCAGATTTAAAGAACAGCTAACTCGAGTTAGCTGTTCTTTAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-621s1c1
Sequence:CCGGCGTTTATGTAGCTGAAAGATTCTCGAGAATCTTTCAGCTACATAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-292s1c1
Sequence:CCGGGTAAGTTCTTACCTTCGATTTCTCGAGAAATCGAAGGTAAGAACTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003201.1-1637s21c1
Sequence:CCGGCGTGAGTATATTGATCCAGAACTCGAGTTCTGGATCAATATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003201.1-444s21c1
Sequence:CCGGGGCGGAGTGGCAGGTATATAACTCGAGTTATATACCTGCCACTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003201.1-292s21c1
Sequence:CCGGGTAAGTTCTTACCTTCGATTTCTCGAGAAATCGAAGGTAAGAACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003201.1-621s21c1
Sequence:CCGGCGTTTATGTAGCTGAAAGATTCTCGAGAATCTTTCAGCTACATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003201
VALIDATED
TFAM MISSION shRNA shRNA Plasmid DNA
transcription factor A, mitochondrial
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-826s1c1
Sequence:CCGGCGTCGCACAATAAAGAAACAACTCGAGTTGTTTCTTTATTGTGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-1637s1c1
Sequence:CCGGCGTGAGTATATTGATCCAGAACTCGAGTTCTGGATCAATATACTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-476s1c1
Sequence:CCGGGCAGATTTAAAGAACAGCTAACTCGAGTTAGCTGTTCTTTAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-621s1c1
Sequence:CCGGCGTTTATGTAGCTGAAAGATTCTCGAGAATCTTTCAGCTACATAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-292s1c1
Sequence:CCGGGTAAGTTCTTACCTTCGATTTCTCGAGAAATCGAAGGTAAGAACTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003201.1-1637s21c1
Sequence:CCGGCGTGAGTATATTGATCCAGAACTCGAGTTCTGGATCAATATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003201.1-444s21c1
Sequence:CCGGGGCGGAGTGGCAGGTATATAACTCGAGTTATATACCTGCCACTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003201.1-292s21c1
Sequence:CCGGGTAAGTTCTTACCTTCGATTTCTCGAGAAATCGAAGGTAAGAACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003201.1-621s21c1
Sequence:CCGGCGTTTATGTAGCTGAAAGATTCTCGAGAATCTTTCAGCTACATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003201
VALIDATED
TFAM MISSION shRNA Lentiviral Transduction Particles
transcription factor A, mitochondrial
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-826s1c1
Sequence:CCGGCGTCGCACAATAAAGAAACAACTCGAGTTGTTTCTTTATTGTGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-1637s1c1
Sequence:CCGGCGTGAGTATATTGATCCAGAACTCGAGTTCTGGATCAATATACTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-476s1c1
Sequence:CCGGGCAGATTTAAAGAACAGCTAACTCGAGTTAGCTGTTCTTTAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-621s1c1
Sequence:CCGGCGTTTATGTAGCTGAAAGATTCTCGAGAATCTTTCAGCTACATAAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003201.1-292s1c1
Sequence:CCGGGTAAGTTCTTACCTTCGATTTCTCGAGAAATCGAAGGTAAGAACTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329900    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003201.1-1637s21c1
Sequence:CCGGCGTGAGTATATTGATCCAGAACTCGAGTTCTGGATCAATATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_003201.1-444s21c1
Sequence:CCGGGGCGGAGTGGCAGGTATATAACTCGAGTTATATACCTGCCACTCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003201.1-292s21c1
Sequence:CCGGGTAAGTTCTTACCTTCGATTTCTCGAGAAATCGAAGGTAAGAACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_003201.1-621s21c1
Sequence:CCGGCGTTTATGTAGCTGAAAGATTCTCGAGAATCTTTCAGCTACATAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009360
VALIDATED
TFAM MISSION shRNA Bacterial Glycerol Stock
transcription factor A, mitochondrial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009360.2-3547s1c1
Sequence:CCGGCCTCAGATTAAGTGCTGAGATCTCGAGATCTCAGCACTTAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-816s1c1
Sequence:CCGGCGGAGACATCTCTGAGCATTACTCGAGTAATGCTCAGAGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-724s1c1
Sequence:CCGGAGGATTCGTTACGACAATGAACTCGAGTTCATTGTCGTAACGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-197s1c1
Sequence:CCGGCGTCTATCAGTCTTGTCTGTACTCGAGTACAGACAAGACTGATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-415s1c1
Sequence:CCGGGCTGAGTGGAAAGCATACAAACTCGAGTTTGTATGCTTTCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-261s21c1
Sequence:CCGGATGAGTTCATACCTTCGATTTCTCGAGAAATCGAAGGTATGAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-902s21c1
Sequence:CCGGTGTCAAACTAGAACGGATAAACTCGAGTTTATCCGTTCTAGTTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-414s21c1
Sequence:CCGGGCTGAGTGGAAAGCATACAAACTCGAGTTTGTATGCTTTCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-723s21c1
Sequence:CCGGAGGATTCGTTACGACAATGAACTCGAGTTCATTGTCGTAACGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-574s21c1
Sequence:CCGGCTCGTTCAGCATATAACATTTCTCGAGAAATGTTATATGCTGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009360
VALIDATED
TFAM MISSION shRNA shRNA Plasmid DNA
transcription factor A, mitochondrial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009360.2-3547s1c1
Sequence:CCGGCCTCAGATTAAGTGCTGAGATCTCGAGATCTCAGCACTTAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-816s1c1
Sequence:CCGGCGGAGACATCTCTGAGCATTACTCGAGTAATGCTCAGAGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-724s1c1
Sequence:CCGGAGGATTCGTTACGACAATGAACTCGAGTTCATTGTCGTAACGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-197s1c1
Sequence:CCGGCGTCTATCAGTCTTGTCTGTACTCGAGTACAGACAAGACTGATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-415s1c1
Sequence:CCGGGCTGAGTGGAAAGCATACAAACTCGAGTTTGTATGCTTTCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-261s21c1
Sequence:CCGGATGAGTTCATACCTTCGATTTCTCGAGAAATCGAAGGTATGAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-902s21c1
Sequence:CCGGTGTCAAACTAGAACGGATAAACTCGAGTTTATCCGTTCTAGTTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-414s21c1
Sequence:CCGGGCTGAGTGGAAAGCATACAAACTCGAGTTTGTATGCTTTCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-723s21c1
Sequence:CCGGAGGATTCGTTACGACAATGAACTCGAGTTCATTGTCGTAACGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-574s21c1
Sequence:CCGGCTCGTTCAGCATATAACATTTCTCGAGAAATGTTATATGCTGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009360
VALIDATED
TFAM MISSION shRNA Lentiviral Transduction Particles
transcription factor A, mitochondrial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009360.2-3547s1c1
Sequence:CCGGCCTCAGATTAAGTGCTGAGATCTCGAGATCTCAGCACTTAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-816s1c1
Sequence:CCGGCGGAGACATCTCTGAGCATTACTCGAGTAATGCTCAGAGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-724s1c1
Sequence:CCGGAGGATTCGTTACGACAATGAACTCGAGTTCATTGTCGTAACGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-197s1c1
Sequence:CCGGCGTCTATCAGTCTTGTCTGTACTCGAGTACAGACAAGACTGATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009360.2-415s1c1
Sequence:CCGGGCTGAGTGGAAAGCATACAAACTCGAGTTTGTATGCTTTCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-261s21c1
Sequence:CCGGATGAGTTCATACCTTCGATTTCTCGAGAAATCGAAGGTATGAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-902s21c1
Sequence:CCGGTGTCAAACTAGAACGGATAAACTCGAGTTTATCCGTTCTAGTTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-414s21c1
Sequence:CCGGGCTGAGTGGAAAGCATACAAACTCGAGTTTGTATGCTTTCCACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-723s21c1
Sequence:CCGGAGGATTCGTTACGACAATGAACTCGAGTTCATTGTCGTAACGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009360.4-574s21c1
Sequence:CCGGCTCGTTCAGCATATAACATTTCTCGAGAAATGTTATATGCTGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks