EMAIL THIS PAGE TO A FRIEND

TFAP2A

transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)

Synonyms: AP-2 AP-2alpha AP2TF BOFS TFAP2
UniProtKB ID: P05549, Q13777, Q5TAV5, Q8N1C6
Gene ID:
Human(7020) Summary: The protein encoded by this gene is a transcription factor that binds the consensus sequence 5'-GCCNNNGGC-3'. The encoded protein functions as either a homodimer or as a heterodimer with similar family members. This protein activates the transcription of some genes while inhibiting the transcription of others. Defects in this gene are a cause of branchiooculofacial syndrome (BOFS). Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
Mouse(21418) transcription factor AP-2, alpha
Rat(306862) transcription factor AP-2 alpha
Zebrafish(140618) transcription factor AP-2 alpha
dog(488213) transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
domestic cat(101096393) transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
chicken(395982) transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
cow(505849) transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
sheep(443109) transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
domestic guinea pig(100732565) transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
Domestic Rabbit(100355868) transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
191 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502948 Anti-AP-2, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
A0844 Anti-AP-2α antibody produced in rabbit affinity isolated antibody, PBS solution chicken, human, mouse
immunofluorescence, microarray, western blot pricing
AV100878 Anti-TFAP2A antibody produced in rabbit IgG fraction of antiserum human, guinea pig, rat, canine, rabbit, mouse
western blot pricing
HPA056871 Anti-TFAP2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA028850 Anti-TFAP2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunofluorescence, immunohistochemistry, western blot pricing
A9981 Monoclonal Anti-AP-2α antibody produced in mouse ~1.0 mg/mL, clone AP2a 8G8/5, purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
A7107 Monoclonal Anti-AP2 antibody produced in mouse ~1.0 mg/mL, clone A6/2/2, purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
WH0007020M1 Monoclonal Anti-TFAP2A antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404459 Monoclonal Anti-TFAP2A antibody produced in mouse clone 3E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003220 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032280 Rosetta Predictions human pricing
NM_001042425 Rosetta Predictions human pricing
NM_003220 Rosetta Predictions human pricing
NM_001107345 Rosetta Predictions rat pricing
NM_001122948 Rosetta Predictions mouse pricing
NM_011547 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080715 predicted 1263
2 SASI_Hs01_00080716 predicted 1699
3 SASI_Hs01_00080717 predicted 1357
4 SASI_Hs01_00080718 predicted 1266
5 SASI_Hs01_00080719 predicted 1508
6 SASI_Hs01_00080720 predicted 1717
7 SASI_Hs01_00080721 predicted 1668
8 SASI_Hs01_00080722 predicted 1233
9 SASI_Hs01_00080723 predicted 1624
10 SASI_Hs01_00080724 predicted 1214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309688 predicted 603
2 SASI_Hs02_00309689 predicted 1037
3 SASI_Hs02_00309690 predicted 695
4 SASI_Hs02_00309691 predicted 599
5 SASI_Hs02_00309692 predicted 852
6 SASI_Hs02_00309693 predicted 1067
7 SASI_Hs02_00309694 predicted 1011
8 SASI_Hs02_00309695 predicted 574
9 SASI_Hs02_00309696 predicted 961
10 SASI_Hs02_00309697 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029830 predicted 757
2 SASI_Hs01_00029831 predicted 1187
3 SASI_Hs01_00029832 predicted 844
4 SASI_Hs01_00029833 predicted 755
5 SASI_Hs01_00029834 predicted 999
6 SASI_Hs01_00029835 predicted 1217
7 SASI_Hs01_00029836 predicted 1160
8 SASI_Hs01_00029837 predicted 728
9 SASI_Hs01_00029838 predicted 1114
10 SASI_Hs01_00029839 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227915 predicted 1196
2 SASI_Rn02_00227916 predicted 1209
3 SASI_Rn02_00227917 predicted 775
4 SASI_Rn02_00227918 predicted 773
5 SASI_Rn02_00227919 predicted 889
6 SASI_Rn02_00227920 predicted 867
7 SASI_Rn02_00227921 predicted 1037
8 SASI_Rn02_00227922 predicted 747
9 SASI_Rn02_00227923 predicted 728
10 SASI_Rn02_00227924 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309599 predicted 1130
2 SASI_Mm02_00309600 predicted 1124
3 SASI_Mm02_00309601 predicted 839
4 SASI_Mm02_00309602 predicted 978
5 SASI_Mm02_00309603 predicted 839
6 SASI_Mm02_00309604 predicted 1322
7 SASI_Mm02_00309605 predicted 1062
8 SASI_Mm02_00309606 predicted 1109
9 SASI_Mm02_00309607 predicted 1338
10 SASI_Mm02_00309608 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011547 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168211 predicted 881
2 SASI_Mm01_00168212 predicted 873
3 SASI_Mm01_00168214 predicted 581
4 SASI_Mm01_00168215 predicted 725
5 SASI_Mm01_00168216 predicted 584
6 SASI_Mm01_00168217 predicted 1070
7 SASI_Mm01_00168219 predicted 817
8 SASI_Mm01_00168220 predicted 856
9 SASI_Mm02_00320898 predicted 1084
10 SASI_Mm02_00320899 predicted 1182
11 SASI_Mm01_00168213 predicted 1262
12 SASI_Mm01_00168218 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011547
VALIDATED
TFAP2A MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-1061s21c1
Sequence:CCGGGCAGAATTTCTCAACCGACAACTCGAGTTGTCGGTTGAGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-676s21c1
Sequence:CCGGTGTCTCCGCCATCCCTATTAACTCGAGTTAATAGGGATGGCGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-1228s21c1
Sequence:CCGGGAGTTGCTTGACCCACTTCAACTCGAGTTGAAGTGGGTCAAGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011547.3-1892s21c1
Sequence:CCGGGCAAAGAGGATAATGACATTTCTCGAGAAATGTCATTATCCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-591s21c1
Sequence:CCGGACGTAGAAGACCCGGGTATTACTCGAGTAATACCCGGGTCTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1851s1c1
Sequence:CCGGCCGCTGCCTACTCAGCGCCTTCTCGAGAAGGCGCTGAGTAGGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1471s1c1
Sequence:CCGGGAGTTGCTTGACCCACTTCAACTCGAGTTGAAGTGGGTCAAGCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011547.2-1276s1c1
Sequence:CCGGCGAAACTGAATTTCCTGCCAACTCGAGTTGGCAGGAAATTCAGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1112s1c1
Sequence:CCGGCGGAGAGCGAAGTCTAAGAATCTCGAGATTCTTAGACTTCGCTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1304s1c1
Sequence:CCGGGCAGAATTTCTCAACCGACAACTCGAGTTGTCGGTTGAGAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011547
VALIDATED
TFAP2A MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-1061s21c1
Sequence:CCGGGCAGAATTTCTCAACCGACAACTCGAGTTGTCGGTTGAGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-676s21c1
Sequence:CCGGTGTCTCCGCCATCCCTATTAACTCGAGTTAATAGGGATGGCGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-1228s21c1
Sequence:CCGGGAGTTGCTTGACCCACTTCAACTCGAGTTGAAGTGGGTCAAGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011547.3-1892s21c1
Sequence:CCGGGCAAAGAGGATAATGACATTTCTCGAGAAATGTCATTATCCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-591s21c1
Sequence:CCGGACGTAGAAGACCCGGGTATTACTCGAGTAATACCCGGGTCTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1851s1c1
Sequence:CCGGCCGCTGCCTACTCAGCGCCTTCTCGAGAAGGCGCTGAGTAGGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1471s1c1
Sequence:CCGGGAGTTGCTTGACCCACTTCAACTCGAGTTGAAGTGGGTCAAGCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011547.2-1276s1c1
Sequence:CCGGCGAAACTGAATTTCCTGCCAACTCGAGTTGGCAGGAAATTCAGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1112s1c1
Sequence:CCGGCGGAGAGCGAAGTCTAAGAATCTCGAGATTCTTAGACTTCGCTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1304s1c1
Sequence:CCGGGCAGAATTTCTCAACCGACAACTCGAGTTGTCGGTTGAGAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011547
VALIDATED
TFAP2A MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-1061s21c1
Sequence:CCGGGCAGAATTTCTCAACCGACAACTCGAGTTGTCGGTTGAGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-676s21c1
Sequence:CCGGTGTCTCCGCCATCCCTATTAACTCGAGTTAATAGGGATGGCGGAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-1228s21c1
Sequence:CCGGGAGTTGCTTGACCCACTTCAACTCGAGTTGAAGTGGGTCAAGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011547.3-1892s21c1
Sequence:CCGGGCAAAGAGGATAATGACATTTCTCGAGAAATGTCATTATCCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011547.3-591s21c1
Sequence:CCGGACGTAGAAGACCCGGGTATTACTCGAGTAATACCCGGGTCTTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012048    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1851s1c1
Sequence:CCGGCCGCTGCCTACTCAGCGCCTTCTCGAGAAGGCGCTGAGTAGGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1471s1c1
Sequence:CCGGGAGTTGCTTGACCCACTTCAACTCGAGTTGAAGTGGGTCAAGCAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011547.2-1276s1c1
Sequence:CCGGCGAAACTGAATTTCCTGCCAACTCGAGTTGGCAGGAAATTCAGTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1112s1c1
Sequence:CCGGCGGAGAGCGAAGTCTAAGAATCTCGAGATTCTTAGACTTCGCTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011547.2-1304s1c1
Sequence:CCGGGCAGAATTTCTCAACCGACAACTCGAGTTGTCGGTTGAGAAATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003220
VALIDATED
TFAP2A MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003220.2-819s21c1
Sequence:CCGGCGTCTCCGCCATCCCTATTAACTCGAGTTAATAGGGATGGCGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003220.2-1235s21c1
Sequence:CCGGCCAATGAGCAAGTGACAAGAACTCGAGTTCTTGTCACTTGCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003220.2-759s21c1
Sequence:CCGGCCCAGATCAAACTGTAATTAACTCGAGTTAATTACAGTTTGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003220.2-2035s21c1
Sequence:CCGGTCAGATTGTAGCCATACTTAACTCGAGTTAAGTATGGCTACAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003220.2-1204s21c1
Sequence:CCGGGCTGAATTTCTCAACCGACAACTCGAGTTGTCGGTTGAGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003220.1-1447s1c1
Sequence:CCGGGCTCCGGGATCAGCAACCCTTCTCGAGAAGGGTTGCTGATCCCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003220.1-555s1c1
Sequence:CCGGCCGGGTATTAACATCCCAGATCTCGAGATCTGGGATGTTAATACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003220.1-1045s1c1
Sequence:CCGGCCAATGAGCAAGTGACAAGAACTCGAGTTCTTGTCACTTGCTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003220.1-569s1c1
Sequence:CCGGCCCAGATCAAACTGTAATTAACTCGAGTTAATTACAGTTTGATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003220
VALIDATED
TFAP2A MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003220.2-819s21c1
Sequence:CCGGCGTCTCCGCCATCCCTATTAACTCGAGTTAATAGGGATGGCGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003220.2-1235s21c1
Sequence:CCGGCCAATGAGCAAGTGACAAGAACTCGAGTTCTTGTCACTTGCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003220.2-759s21c1
Sequence:CCGGCCCAGATCAAACTGTAATTAACTCGAGTTAATTACAGTTTGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003220.2-2035s21c1
Sequence:CCGGTCAGATTGTAGCCATACTTAACTCGAGTTAAGTATGGCTACAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003220.2-1204s21c1
Sequence:CCGGGCTGAATTTCTCAACCGACAACTCGAGTTGTCGGTTGAGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003220.1-1447s1c1
Sequence:CCGGGCTCCGGGATCAGCAACCCTTCTCGAGAAGGGTTGCTGATCCCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003220.1-555s1c1
Sequence:CCGGCCGGGTATTAACATCCCAGATCTCGAGATCTGGGATGTTAATACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003220.1-1045s1c1
Sequence:CCGGCCAATGAGCAAGTGACAAGAACTCGAGTTCTTGTCACTTGCTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003220.1-569s1c1
Sequence:CCGGCCCAGATCAAACTGTAATTAACTCGAGTTAATTACAGTTTGATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003220
VALIDATED
TFAP2A MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003220.2-819s21c1
Sequence:CCGGCGTCTCCGCCATCCCTATTAACTCGAGTTAATAGGGATGGCGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003220.2-1235s21c1
Sequence:CCGGCCAATGAGCAAGTGACAAGAACTCGAGTTCTTGTCACTTGCTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003220.2-759s21c1
Sequence:CCGGCCCAGATCAAACTGTAATTAACTCGAGTTAATTACAGTTTGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003220.2-2035s21c1
Sequence:CCGGTCAGATTGTAGCCATACTTAACTCGAGTTAAGTATGGCTACAATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003220.2-1204s21c1
Sequence:CCGGGCTGAATTTCTCAACCGACAACTCGAGTTGTCGGTTGAGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003220.1-1447s1c1
Sequence:CCGGGCTCCGGGATCAGCAACCCTTCTCGAGAAGGGTTGCTGATCCCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003220.1-555s1c1
Sequence:CCGGCCGGGTATTAACATCCCAGATCTCGAGATCTGGGATGTTAATACCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003220.1-1045s1c1
Sequence:CCGGCCAATGAGCAAGTGACAAGAACTCGAGTTCTTGTCACTTGCTCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003220.1-569s1c1
Sequence:CCGGCCCAGATCAAACTGTAATTAACTCGAGTTAATTACAGTTTGATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks