EMAIL THIS PAGE TO A FRIEND

TFAP2B

transcription factor AP-2 beta (activating enhancer binding protein 2 beta)

Synonyms: AP-2B AP2-B
Gene ID:
Human(7021) Summary: This gene encodes a member of the AP-2 family of transcription factors. AP-2 proteins form homo- or hetero-dimers with other AP-2 family members and bind specific DNA sequences. They are thought to stimulate cell proliferation and suppress terminal differentiation of specific cell types during embryonic development. Specific AP-2 family members differ in their expression patterns and binding affinity for different promoters. This protein functions as both a transcriptional activator and repressor. Mutations in this gene result in autosomal dominant Char syndrome, suggesting that this gene functions in the differentiation of neural crest cell derivatives. [provided by RefSeq, Jul 2008]
Mouse(21419) transcription factor AP-2 beta
Rat(301285) transcription factor AP-2 beta
Zebrafish(550545) transcription factor AP-2 beta
Horse(100056210) transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
chicken(395713) transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
dog(403463) transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
domestic cat(101082823) transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
naked mole-rat(101722192) transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
domestic guinea pig(100734740) transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
cow(282381) transcription factor AP-2 beta
sheep(101103431) transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
cow(540867) transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
202 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38282 Anti-TFAP2B (AB1) antibody produced in rabbit affinity isolated antibody canine, rat, bovine, human, guinea pig, zebrafish, mouse, horse
western blot pricing
AV38283 Anti-TFAP2B (AB2) antibody produced in rabbit affinity isolated antibody bovine, canine, mouse, human, guinea pig, rat, horse, sheep, rabbit, zebrafish,
western blot pricing
AV33432 Anti-TFAP2B antibody produced in rabbit IgG fraction of antiserum guinea pig, sheep, human, canine, mouse, bovine, zebrafish, pig, horse, rabbit, rat
western blot pricing
SAB2102407 Anti-TFAP2B antibody produced in rabbit affinity isolated antibody bovine, human, horse, canine, zebrafish, rabbit, rat, mouse
western blot pricing
HPA034683 Anti-TFAP2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA062942 Anti-TFAP2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, immunohistochemistry pricing
SAB2103160 Anti-TFAP2B, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, canine, horse, rabbit, human, mouse, guinea pig, sheep
western blot pricing
A9856 Monoclonal Anti-AP-2β antibody produced in mouse ~1 mg/mL, clone AP2b 1F3/8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0007021M1 Monoclonal Anti-TFAP2B antibody produced in mouse clone 3G5-1D11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404460 Monoclonal Anti-TFAP2B antibody produced in mouse clone 2F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003221 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059961 MISSION® esiRNA esiRNA human TFAP2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003221 Rosetta Predictions human pricing
NM_001106896 Rosetta Predictions rat pricing
NM_001025305 Rosetta Predictions mouse pricing
NM_009334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086710 predicted 778
2 SASI_Hs01_00086711 predicted 1173
3 SASI_Hs01_00086712 predicted 1232
4 SASI_Hs01_00086713 predicted 1206
5 SASI_Hs01_00086714 predicted 1104
6 SASI_Hs01_00086715 predicted 495
7 SASI_Hs01_00086716 predicted 868
8 SASI_Hs02_00335255 predicted 731
9 SASI_Hs01_00086717 predicted 350
10 SASI_Hs01_00086719 predicted 732
11 SASI_Hs01_00086718 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223476 predicted 909
2 SASI_Rn02_00223477 predicted 1222
3 SASI_Rn02_00223478 predicted 1631
4 SASI_Rn02_00223479 predicted 1236
5 SASI_Rn02_00223480 predicted 854
6 SASI_Rn02_00223481 predicted 1163
7 SASI_Rn02_00223482 predicted 1527
8 SASI_Rn02_00223483 predicted 787
9 SASI_Rn02_00223484 predicted 1151
10 SASI_Rn02_00223485 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195065 predicted 862
2 SASI_Mm01_00195066 predicted 993
3 SASI_Mm01_00195067 predicted 1204
4 SASI_Mm01_00195069 predicted 950
5 SASI_Mm01_00195070 predicted 1276
6 SASI_Mm01_00195072 predicted 1187
7 SASI_Mm01_00195073 predicted 1231
8 SASI_Mm01_00195074 predicted 854
9 SASI_Mm02_00287825 predicted 1103
10 SASI_Mm02_00287826 predicted 837
11 SASI_Mm01_00195068 predicted 1104
12 SASI_Mm01_00195071 predicted 1000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093313 predicted 825
2 SASI_Mm01_00093314 predicted 951
3 SASI_Mm01_00093315 predicted 1171
4 SASI_Mm01_00093317 predicted 916
5 SASI_Mm01_00093318 predicted 1247
6 SASI_Mm01_00093320 predicted 1149
7 SASI_Mm01_00093321 predicted 1197
8 SASI_Mm01_00093322 predicted 817
9 SASI_Mm02_00315892 predicted 1064
10 SASI_Mm02_00315893 predicted 804
11 SASI_Mm01_00093316 predicted 1070
12 SASI_Mm01_00093319 predicted 971
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003221
TFAP2B MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003221.2-1658s1c1
Sequence:CCGGCGGTTCTTTCGAGTTTAGTAACTCGAGTTACTAAACTCGAAAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003221.2-1075s1c1
Sequence:CCGGCTCCCGAAAGAATATGCTGTTCTCGAGAACAGCATATTCTTTCGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003221.2-560s1c1
Sequence:CCGGCAGTCAGTTGAAGATGCCAATCTCGAGATTGGCATCTTCAACTGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003221.2-968s1c1
Sequence:CCGGGCTGTTCACTTAGCTAGGGATCTCGAGATCCCTAGCTAAGTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-743s21c1
Sequence:CCGGTTGGACCAGTCTGTCATTAAACTCGAGTTTAATGACAGACTGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003221.3-1722s21c1
Sequence:CCGGGCGTACAACGGAGCAACAATACTCGAGTATTGTTGCTCCGTTGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-1140s21c1
Sequence:CCGGACATTTGCGAAACGGAGTTTCCTCGAGGAAACTCCGTTTCGCAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-888s21c1
Sequence:CCGGGTTCAACTTCGAAGTACAAAGCTCGAGCTTTGTACTTCGAAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-1165s21c1
Sequence:CCGGCAAAGCCGTCTCTGAGTATTTCTCGAGAAATACTCAGAGACGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003221.3-1774s21c1
Sequence:CCGGTGGAGACAACCGTCCGGATTTCTCGAGAAATCCGGACGGTTGTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003221
TFAP2B MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003221.2-1658s1c1
Sequence:CCGGCGGTTCTTTCGAGTTTAGTAACTCGAGTTACTAAACTCGAAAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003221.2-1075s1c1
Sequence:CCGGCTCCCGAAAGAATATGCTGTTCTCGAGAACAGCATATTCTTTCGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003221.2-560s1c1
Sequence:CCGGCAGTCAGTTGAAGATGCCAATCTCGAGATTGGCATCTTCAACTGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003221.2-968s1c1
Sequence:CCGGGCTGTTCACTTAGCTAGGGATCTCGAGATCCCTAGCTAAGTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-743s21c1
Sequence:CCGGTTGGACCAGTCTGTCATTAAACTCGAGTTTAATGACAGACTGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003221.3-1722s21c1
Sequence:CCGGGCGTACAACGGAGCAACAATACTCGAGTATTGTTGCTCCGTTGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-1140s21c1
Sequence:CCGGACATTTGCGAAACGGAGTTTCCTCGAGGAAACTCCGTTTCGCAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-888s21c1
Sequence:CCGGGTTCAACTTCGAAGTACAAAGCTCGAGCTTTGTACTTCGAAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-1165s21c1
Sequence:CCGGCAAAGCCGTCTCTGAGTATTTCTCGAGAAATACTCAGAGACGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003221.3-1774s21c1
Sequence:CCGGTGGAGACAACCGTCCGGATTTCTCGAGAAATCCGGACGGTTGTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003221
TFAP2B MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019659    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003221.2-1658s1c1
Sequence:CCGGCGGTTCTTTCGAGTTTAGTAACTCGAGTTACTAAACTCGAAAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003221.2-1075s1c1
Sequence:CCGGCTCCCGAAAGAATATGCTGTTCTCGAGAACAGCATATTCTTTCGGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003221.2-560s1c1
Sequence:CCGGCAGTCAGTTGAAGATGCCAATCTCGAGATTGGCATCTTCAACTGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003221.2-968s1c1
Sequence:CCGGGCTGTTCACTTAGCTAGGGATCTCGAGATCCCTAGCTAAGTGAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-743s21c1
Sequence:CCGGTTGGACCAGTCTGTCATTAAACTCGAGTTTAATGACAGACTGGTCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003221.3-1722s21c1
Sequence:CCGGGCGTACAACGGAGCAACAATACTCGAGTATTGTTGCTCCGTTGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-1140s21c1
Sequence:CCGGACATTTGCGAAACGGAGTTTCCTCGAGGAAACTCCGTTTCGCAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-888s21c1
Sequence:CCGGGTTCAACTTCGAAGTACAAAGCTCGAGCTTTGTACTTCGAAGTTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003221.3-1165s21c1
Sequence:CCGGCAAAGCCGTCTCTGAGTATTTCTCGAGAAATACTCAGAGACGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003221.3-1774s21c1
Sequence:CCGGTGGAGACAACCGTCCGGATTTCTCGAGAAATCCGGACGGTTGTCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025305
TFAP2B MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025305.1-4536s1c1
Sequence:CCGGCCGGCTACATTTATCTGATAACTCGAGTTATCAGATAAATGTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-1236s1c1
Sequence:CCGGCTGTTCACTTAGCTCGGGATTCTCGAGAATCCCGAGCTAAGTGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-1582s1c1
Sequence:CCGGGTTCTTGAACAACACCACTAACTCGAGTTAGTGGTGTTGTTCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-1137s1c1
Sequence:CCGGCCTTGAGAGAAAGGCTAGAAACTCGAGTTTCTAGCCTTTCTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-993s1c1
Sequence:CCGGGCCGTTTATCTCTACTCAGTTCTCGAGAACTGAGTAGAGATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025305.1-1287s21c1
Sequence:CCGGCTAAAGCCGTGTCCGAGTATTCTCGAGAATACTCGGACACGGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025305.1-1919s21c1
Sequence:CCGGACTTCGGTTCTTTCGAATTTACTCGAGTAAATTCGAAAGAACCGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025305
TFAP2B MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025305.1-4536s1c1
Sequence:CCGGCCGGCTACATTTATCTGATAACTCGAGTTATCAGATAAATGTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-1236s1c1
Sequence:CCGGCTGTTCACTTAGCTCGGGATTCTCGAGAATCCCGAGCTAAGTGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-1582s1c1
Sequence:CCGGGTTCTTGAACAACACCACTAACTCGAGTTAGTGGTGTTGTTCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-1137s1c1
Sequence:CCGGCCTTGAGAGAAAGGCTAGAAACTCGAGTTTCTAGCCTTTCTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-993s1c1
Sequence:CCGGGCCGTTTATCTCTACTCAGTTCTCGAGAACTGAGTAGAGATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025305.1-1287s21c1
Sequence:CCGGCTAAAGCCGTGTCCGAGTATTCTCGAGAATACTCGGACACGGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025305.1-1919s21c1
Sequence:CCGGACTTCGGTTCTTTCGAATTTACTCGAGTAAATTCGAAAGAACCGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025305
TFAP2B MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 beta (activating enhancer binding protein 2 beta)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025305.1-4536s1c1
Sequence:CCGGCCGGCTACATTTATCTGATAACTCGAGTTATCAGATAAATGTAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-1236s1c1
Sequence:CCGGCTGTTCACTTAGCTCGGGATTCTCGAGAATCCCGAGCTAAGTGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-1582s1c1
Sequence:CCGGGTTCTTGAACAACACCACTAACTCGAGTTAGTGGTGTTGTTCAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-1137s1c1
Sequence:CCGGCCTTGAGAGAAAGGCTAGAAACTCGAGTTTCTAGCCTTTCTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025305.1-993s1c1
Sequence:CCGGGCCGTTTATCTCTACTCAGTTCTCGAGAACTGAGTAGAGATAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025305.1-1287s21c1
Sequence:CCGGCTAAAGCCGTGTCCGAGTATTCTCGAGAATACTCGGACACGGCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025305.1-1919s21c1
Sequence:CCGGACTTCGGTTCTTTCGAATTTACTCGAGTAAATTCGAAAGAACCGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks