EMAIL THIS PAGE TO A FRIEND

TFAP2C

transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)

Synonyms: AP2-GAMMA ERF1 TFAP2G hAP-2g
UniProtKB ID: Q92754, O00685, O00730, Q86V30, Q8IVB6, Q9P1X2
Gene ID:
Human(7022) Summary: The protein encoded by this gene is a sequence-specific DNA-binding transcription factor involved in the activation of several developmental genes. The encoded protein can act as either a homodimer or heterodimer with other family members and is induced during retinoic acid-mediated differentiation. It plays a role in the development of the eyes, face, body wall, limbs, and neural tube. [provided by RefSeq, Jul 2008]
Mouse(21420) transcription factor AP-2, gamma
Rat(362280) transcription factor AP-2 gamma
cow(511317) transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
sheep(101104925) transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
domestic guinea pig(100719843) transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
naked mole-rat(101705471) transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
Domestic Rabbit(100345121) transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
Zebrafish(494033) transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
domestic cat(101094410) transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
dog(485941) transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
chicken(419327) transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502949 Anti-AP2C, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
AV40141 Anti-TCFAP2C antibody produced in rabbit IgG fraction of antiserum mouse, rat
western blot pricing
SAB2501154 Anti-TFAP2C (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunohistochemistry pricing
AV38284 Anti-TFAP2C antibody produced in rabbit IgG fraction of antiserum bovine, canine, rabbit, zebrafish, pig, rat, horse, human, guinea pig, mouse
immunohistochemistry, western blot pricing
SAB2102408 Anti-TFAP2C antibody produced in rabbit affinity isolated antibody canine, zebrafish, sheep, human, pig, rat, rabbit, horse, guinea pig, bovine, mouse
western blot pricing
SAB2103536 Anti-TFAP2C antibody produced in rabbit affinity isolated antibody , zebrafish, rabbit, horse, human, canine, pig, mouse, rat, guinea pig, bovine, sheep
western blot pricing
HPA055179 Anti-TFAP2C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA057076 Anti-TFAP2C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
A3108 Monoclonal Anti-AP-2γ antibody produced in mouse ~1.0 mg/mL, clone AP2g 6E4/4, purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
WH0007022M1 Monoclonal Anti-TFAP2C antibody produced in mouse clone 3C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009335 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009335 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009335 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003222 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003222 Rosetta Predictions human pricing
NM_201420 Rosetta Predictions rat pricing
NM_009335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132324 predicted 1289
2 SASI_Hs02_00335256 predicted 1323
3 SASI_Hs02_00335257 predicted 1214
4 SASI_Hs02_00335258 predicted 1251
5 SASI_Hs01_00132327 predicted 1187
6 SASI_Hs01_00132328 predicted 1012
7 SASI_Hs01_00132329 predicted 944
8 SASI_Hs01_00132331 predicted 1170
9 SASI_Hs01_00132332 predicted 1179
10 SASI_Hs01_00132333 predicted 810
11 SASI_Hs01_00132325 predicted 1213
12 SASI_Hs01_00132326 predicted 1496
13 SASI_Hs01_00132330 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201420 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043987 predicted 1461
2 SASI_Rn02_00270316 predicted 1104
3 SASI_Rn01_00043988 predicted 421
4 SASI_Rn01_00043989 predicted 1436
5 SASI_Rn01_00043990 predicted 1396
6 SASI_Rn02_00270317 predicted 1280
7 SASI_Rn01_00043991 predicted 1089
8 SASI_Rn01_00043992 predicted 1311
9 SASI_Rn01_00043994 predicted 425
10 SASI_Rn01_00043995 predicted 1298
11 SASI_Rn01_00043993 predicted 1075
12 SASI_Rn01_00043996 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063603 predicted 441
2 SASI_Mm01_00063604 predicted 1397
3 SASI_Mm01_00063605 predicted 1299
4 SASI_Mm01_00063606 predicted 795
5 SASI_Mm01_00063607 predicted 396
6 SASI_Mm01_00063608 predicted 565
7 SASI_Mm01_00063609 predicted 1516
8 SASI_Mm01_00063610 predicted 1002
9 SASI_Mm02_00315894 predicted 798
10 SASI_Mm01_00063611 predicted 1387
11 SASI_Mm01_00063612 predicted 1387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009335
TFAP2C MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-815s21c1
Sequence:CCGGCATTCGCAAAGGACCCATTTCCTCGAGGAAATGGGTCCTTTGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-597s21c1
Sequence:CCGGAGCCGCTCTGCAAGTCTAATACTCGAGTATTAGACTTGCAGAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009335.2-1966s21c1
Sequence:CCGGGATCGATCAATCATAACTTATCTCGAGATAAGTTATGATTGATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-1466s21c1
Sequence:CCGGCTCCGCAGTGCAGAATTATATCTCGAGATATAATTCTGCACTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-1220s21c1
Sequence:CCGGTAAAGCGGTGGCTGACTATTTCTCGAGAAATAGTCAGCCACCGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-1448s1c1
Sequence:CCGGCGCAGTGCAGAATTATATCAACTCGAGTTGATATAATTCTGCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-925s1c1
Sequence:CCGGCCACGTCGAAGTACAAAGTAACTCGAGTTACTTTGTACTTCGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009335.1-2111s1c1
Sequence:CCGGGCAGCTACTTACCAGTGGTATCTCGAGATACCACTGGTAAGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-777s1c1
Sequence:CCGGCTACACGATCAGACTGTCATTCTCGAGAATGACAGTCTGATCGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-1212s1c1
Sequence:CCGGGACTATTTAACGAGACCACATCTCGAGATGTGGTCTCGTTAAATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009335
TFAP2C MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-815s21c1
Sequence:CCGGCATTCGCAAAGGACCCATTTCCTCGAGGAAATGGGTCCTTTGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-597s21c1
Sequence:CCGGAGCCGCTCTGCAAGTCTAATACTCGAGTATTAGACTTGCAGAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009335.2-1966s21c1
Sequence:CCGGGATCGATCAATCATAACTTATCTCGAGATAAGTTATGATTGATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-1466s21c1
Sequence:CCGGCTCCGCAGTGCAGAATTATATCTCGAGATATAATTCTGCACTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-1220s21c1
Sequence:CCGGTAAAGCGGTGGCTGACTATTTCTCGAGAAATAGTCAGCCACCGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-1448s1c1
Sequence:CCGGCGCAGTGCAGAATTATATCAACTCGAGTTGATATAATTCTGCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-925s1c1
Sequence:CCGGCCACGTCGAAGTACAAAGTAACTCGAGTTACTTTGTACTTCGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009335.1-2111s1c1
Sequence:CCGGGCAGCTACTTACCAGTGGTATCTCGAGATACCACTGGTAAGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-777s1c1
Sequence:CCGGCTACACGATCAGACTGTCATTCTCGAGAATGACAGTCTGATCGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-1212s1c1
Sequence:CCGGGACTATTTAACGAGACCACATCTCGAGATGTGGTCTCGTTAAATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009335
TFAP2C MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-815s21c1
Sequence:CCGGCATTCGCAAAGGACCCATTTCCTCGAGGAAATGGGTCCTTTGCGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-597s21c1
Sequence:CCGGAGCCGCTCTGCAAGTCTAATACTCGAGTATTAGACTTGCAGAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009335.2-1966s21c1
Sequence:CCGGGATCGATCAATCATAACTTATCTCGAGATAAGTTATGATTGATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-1466s21c1
Sequence:CCGGCTCCGCAGTGCAGAATTATATCTCGAGATATAATTCTGCACTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009335.2-1220s21c1
Sequence:CCGGTAAAGCGGTGGCTGACTATTTCTCGAGAAATAGTCAGCCACCGCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-1448s1c1
Sequence:CCGGCGCAGTGCAGAATTATATCAACTCGAGTTGATATAATTCTGCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-925s1c1
Sequence:CCGGCCACGTCGAAGTACAAAGTAACTCGAGTTACTTTGTACTTCGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009335.1-2111s1c1
Sequence:CCGGGCAGCTACTTACCAGTGGTATCTCGAGATACCACTGGTAAGTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-777s1c1
Sequence:CCGGCTACACGATCAGACTGTCATTCTCGAGAATGACAGTCTGATCGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009335.1-1212s1c1
Sequence:CCGGGACTATTTAACGAGACCACATCTCGAGATGTGGTCTCGTTAAATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003222
VALIDATED
TFAP2C MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-1700s21c1
Sequence:CCGGTGTTACCTACCTTACTATTTACTCGAGTAAATAGTAAGGTAGGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-942s21c1
Sequence:CCGGCCTCAGCTCTACGTCTAAATACTCGAGTATTTAGACGTAGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-1196s21c1
Sequence:CCGGCCTATGTCTGTGAAGCCGAATCTCGAGATTCGGCTTCACAGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003222.3-385s21c1
Sequence:CCGGCACACTGGAGTCGCCGAATATCTCGAGATATTCGGCGACTCCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-1306s21c1
Sequence:CCGGGCCCAGCAACTGTGTAAAGAACTCGAGTTCTTTACACAGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1779s1c1
Sequence:CCGGGCTGAGCTATCTCCTAACTTTCTCGAGAAAGTTAGGAGATAGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-942s1c1
Sequence:CCGGCCTCAGCTCTACGTCTAAATACTCGAGTATTTAGACGTAGAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1306s1c1
Sequence:CCGGGCCCAGCAACTGTGTAAAGAACTCGAGTTCTTTACACAGTTGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1196s1c1
Sequence:CCGGCCTATGTCTGTGAAGCCGAATCTCGAGATTCGGCTTCACAGACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1498s1c1
Sequence:CCGGGCCCTGATTGTCATAGACAAACTCGAGTTTGTCTATGACAATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003222
VALIDATED
TFAP2C MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-1700s21c1
Sequence:CCGGTGTTACCTACCTTACTATTTACTCGAGTAAATAGTAAGGTAGGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-942s21c1
Sequence:CCGGCCTCAGCTCTACGTCTAAATACTCGAGTATTTAGACGTAGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-1196s21c1
Sequence:CCGGCCTATGTCTGTGAAGCCGAATCTCGAGATTCGGCTTCACAGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003222.3-385s21c1
Sequence:CCGGCACACTGGAGTCGCCGAATATCTCGAGATATTCGGCGACTCCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-1306s21c1
Sequence:CCGGGCCCAGCAACTGTGTAAAGAACTCGAGTTCTTTACACAGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1779s1c1
Sequence:CCGGGCTGAGCTATCTCCTAACTTTCTCGAGAAAGTTAGGAGATAGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-942s1c1
Sequence:CCGGCCTCAGCTCTACGTCTAAATACTCGAGTATTTAGACGTAGAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1306s1c1
Sequence:CCGGGCCCAGCAACTGTGTAAAGAACTCGAGTTCTTTACACAGTTGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1196s1c1
Sequence:CCGGCCTATGTCTGTGAAGCCGAATCTCGAGATTCGGCTTCACAGACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1498s1c1
Sequence:CCGGGCCCTGATTGTCATAGACAAACTCGAGTTTGTCTATGACAATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003222
VALIDATED
TFAP2C MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-1700s21c1
Sequence:CCGGTGTTACCTACCTTACTATTTACTCGAGTAAATAGTAAGGTAGGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-942s21c1
Sequence:CCGGCCTCAGCTCTACGTCTAAATACTCGAGTATTTAGACGTAGAGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-1196s21c1
Sequence:CCGGCCTATGTCTGTGAAGCCGAATCTCGAGATTCGGCTTCACAGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003222.3-385s21c1
Sequence:CCGGCACACTGGAGTCGCCGAATATCTCGAGATATTCGGCGACTCCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_003222.3-1306s21c1
Sequence:CCGGGCCCAGCAACTGTGTAAAGAACTCGAGTTCTTTACACAGTTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019744    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1779s1c1
Sequence:CCGGGCTGAGCTATCTCCTAACTTTCTCGAGAAAGTTAGGAGATAGCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-942s1c1
Sequence:CCGGCCTCAGCTCTACGTCTAAATACTCGAGTATTTAGACGTAGAGCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1306s1c1
Sequence:CCGGGCCCAGCAACTGTGTAAAGAACTCGAGTTCTTTACACAGTTGCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1196s1c1
Sequence:CCGGCCTATGTCTGTGAAGCCGAATCTCGAGATTCGGCTTCACAGACATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003222.3-1498s1c1
Sequence:CCGGGCCCTGATTGTCATAGACAAACTCGAGTTTGTCTATGACAATCAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks