EMAIL THIS PAGE TO A FRIEND

TFAP2D

transcription factor AP-2 delta (activating enhancer binding protein 2 delta)

Synonyms: TFAP2BL1
UniProtKB ID: Q7Z6R9, Q8IWX0
Gene ID:
Mouse(226896) transcription factor AP-2, delta
Rat(301284) transcription factor AP-2 delta
Zebrafish(566838) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
Horse(100056165) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
chicken(771525) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
domestic cat(101082569) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
dog(481835) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
Domestic Rabbit(100338157) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
naked mole-rat(101723588) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
domestic guinea pig(100729003) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
cow(539910) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
sheep(101103191) transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172238 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153154 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153154 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153154 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172238 Rosetta Predictions human pricing
NM_001106895 Rosetta Predictions rat pricing
NM_153154 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367945 predicted 1529
2 SASI_Hs01_00063556 predicted 1355
3 SASI_Hs01_00063557 predicted 1682
4 SASI_Hs01_00063561 predicted 1676
5 SASI_Hs01_00063562 predicted 1698
6 SASI_Hs01_00063563 predicted 1558
7 SASI_Hs01_00063564 predicted 1299
8 SASI_Hs02_00367946 predicted 1598
9 SASI_Hs02_00367947 predicted 1324
10 SASI_Hs01_00063565 predicted 1644
11 SASI_Hs01_00063558 predicted 1717
12 SASI_Hs01_00063559 predicted 1097
13 SASI_Hs01_00063560 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106895 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223466 predicted 616
2 SASI_Rn02_00223467 predicted 752
3 SASI_Rn02_00223468 predicted 843
4 SASI_Rn02_00223469 predicted 391
5 SASI_Rn02_00223470 predicted 455
6 SASI_Rn02_00223471 predicted 573
7 SASI_Rn02_00223472 predicted 785
8 SASI_Rn02_00223473 predicted 684
9 SASI_Rn02_00223474 predicted 748
10 SASI_Rn02_00223475 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153154 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140049 predicted 1270
2 SASI_Mm01_00140050 predicted 1374
3 SASI_Mm01_00140051 predicted 1433
4 SASI_Mm01_00140053 predicted 848
5 SASI_Mm01_00140054 predicted 1144
6 SASI_Mm01_00140057 predicted 1058
7 SASI_Mm01_00140058 predicted 819
8 SASI_Mm02_00343040 predicted 1374
9 SASI_Mm02_00343041 predicted 1426
10 SASI_Mm02_00343042 predicted 1397
11 SASI_Mm01_00140052 predicted 1120
12 SASI_Mm01_00140055 predicted 1084
13 SASI_Mm01_00140056 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172238
TFAP2D MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-563s1c1
Sequence:CCGGCGGATCAAACAGCTACCGTTTCTCGAGAAACGGTAGCTGTTTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-845s1c1
Sequence:CCGGCGACTTTATTAACCTGCACAACTCGAGTTGTGCAGGTTAATAAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-1530s1c1
Sequence:CCGGGCGACCAAACAAATCTGTAAACTCGAGTTTACAGATTTGTTTGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-1330s1c1
Sequence:CCGGGCTTAAACTTACCAGCAGGAACTCGAGTTCCTGCTGGTAAGTTTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-1628s1c1
Sequence:CCGGCCAGAGACATTTAACACATTTCTCGAGAAATGTGTTAAATGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172238.3-1666s21c1
Sequence:CCGGGCTTTGGGACTCCGGCAATATCTCGAGATATTGCCGGAGTCCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172238.3-727s21c1
Sequence:CCGGAGTCCTTCCATTACGAGTTTCCTCGAGGAAACTCGTAATGGAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172238.3-613s21c1
Sequence:CCGGCCAATTCCACTGTCGCCTATTCTCGAGAATAGGCGACAGTGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172238
TFAP2D MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-563s1c1
Sequence:CCGGCGGATCAAACAGCTACCGTTTCTCGAGAAACGGTAGCTGTTTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-845s1c1
Sequence:CCGGCGACTTTATTAACCTGCACAACTCGAGTTGTGCAGGTTAATAAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-1530s1c1
Sequence:CCGGGCGACCAAACAAATCTGTAAACTCGAGTTTACAGATTTGTTTGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-1330s1c1
Sequence:CCGGGCTTAAACTTACCAGCAGGAACTCGAGTTCCTGCTGGTAAGTTTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-1628s1c1
Sequence:CCGGCCAGAGACATTTAACACATTTCTCGAGAAATGTGTTAAATGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172238.3-1666s21c1
Sequence:CCGGGCTTTGGGACTCCGGCAATATCTCGAGATATTGCCGGAGTCCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172238.3-727s21c1
Sequence:CCGGAGTCCTTCCATTACGAGTTTCCTCGAGGAAACTCGTAATGGAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172238.3-613s21c1
Sequence:CCGGCCAATTCCACTGTCGCCTATTCTCGAGAATAGGCGACAGTGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172238
TFAP2D MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-563s1c1
Sequence:CCGGCGGATCAAACAGCTACCGTTTCTCGAGAAACGGTAGCTGTTTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-845s1c1
Sequence:CCGGCGACTTTATTAACCTGCACAACTCGAGTTGTGCAGGTTAATAAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-1530s1c1
Sequence:CCGGGCGACCAAACAAATCTGTAAACTCGAGTTTACAGATTTGTTTGGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-1330s1c1
Sequence:CCGGGCTTAAACTTACCAGCAGGAACTCGAGTTCCTGCTGGTAAGTTTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172238.1-1628s1c1
Sequence:CCGGCCAGAGACATTTAACACATTTCTCGAGAAATGTGTTAAATGTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172238.3-1666s21c1
Sequence:CCGGGCTTTGGGACTCCGGCAATATCTCGAGATATTGCCGGAGTCCCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172238.3-727s21c1
Sequence:CCGGAGTCCTTCCATTACGAGTTTCCTCGAGGAAACTCGTAATGGAAGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172238.3-613s21c1
Sequence:CCGGCCAATTCCACTGTCGCCTATTCTCGAGAATAGGCGACAGTGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153154
TFAP2D MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153154.1-1621s1c1
Sequence:CCGGCTGCATCAAACAGAATCTATTCTCGAGAATAGATTCTGTTTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-919s1c1
Sequence:CCGGCTTCTCAGTTCTACTTCCAAACTCGAGTTTGGAAGTAGAACTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-595s1c1
Sequence:CCGGGACTTTATTAACCTGCACAATCTCGAGATTGTGCAGGTTAATAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-389s1c1
Sequence:CCGGCCTCTCCTTTAACTTACTCTACTCGAGTAGAGTAAGTTAAAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-1464s1c1
Sequence:CCGGCCTCAGTGAGATGCTTAACTACTCGAGTAGTTAAGCATCTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153154.2-274s21c1
Sequence:CCGGATACGTCACGACGGATCAAACCTCGAGGTTTGATCCGTCGTGACGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153154.2-1151s21c1
Sequence:CCGGACACGTGTGAAACCGAGTTTCCTCGAGGAAACTCGGTTTCACACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153154
TFAP2D MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153154.1-1621s1c1
Sequence:CCGGCTGCATCAAACAGAATCTATTCTCGAGAATAGATTCTGTTTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-919s1c1
Sequence:CCGGCTTCTCAGTTCTACTTCCAAACTCGAGTTTGGAAGTAGAACTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-595s1c1
Sequence:CCGGGACTTTATTAACCTGCACAATCTCGAGATTGTGCAGGTTAATAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-389s1c1
Sequence:CCGGCCTCTCCTTTAACTTACTCTACTCGAGTAGAGTAAGTTAAAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-1464s1c1
Sequence:CCGGCCTCAGTGAGATGCTTAACTACTCGAGTAGTTAAGCATCTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153154.2-274s21c1
Sequence:CCGGATACGTCACGACGGATCAAACCTCGAGGTTTGATCCGTCGTGACGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153154.2-1151s21c1
Sequence:CCGGACACGTGTGAAACCGAGTTTCCTCGAGGAAACTCGGTTTCACACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153154
TFAP2D MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 delta (activating enhancer binding protein 2 delta)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153154.1-1621s1c1
Sequence:CCGGCTGCATCAAACAGAATCTATTCTCGAGAATAGATTCTGTTTGATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-919s1c1
Sequence:CCGGCTTCTCAGTTCTACTTCCAAACTCGAGTTTGGAAGTAGAACTGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-595s1c1
Sequence:CCGGGACTTTATTAACCTGCACAATCTCGAGATTGTGCAGGTTAATAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-389s1c1
Sequence:CCGGCCTCTCCTTTAACTTACTCTACTCGAGTAGAGTAAGTTAAAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153154.1-1464s1c1
Sequence:CCGGCCTCAGTGAGATGCTTAACTACTCGAGTAGTTAAGCATCTCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153154.2-274s21c1
Sequence:CCGGATACGTCACGACGGATCAAACCTCGAGGTTTGATCCGTCGTGACGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153154.2-1151s21c1
Sequence:CCGGACACGTGTGAAACCGAGTTTCCTCGAGGAAACTCGGTTTCACACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks