EMAIL THIS PAGE TO A FRIEND

TFAP2E

transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)

Synonyms: AP2E
UniProtKB ID: Q6VUC0, Q8IW12
Gene ID:
Mouse(332937) transcription factor AP-2, epsilon
Rat(313596) transcription factor AP-2 epsilon
cow(525824) transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
sheep(101116009) transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
domestic guinea pig(100734073) transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
naked mole-rat(101710451) transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
Zebrafish(393794) transcription factor AP-2 epsilon
domestic cat(101085558) transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
chicken(419631) transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
dog(482482) transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178548 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU154241 MISSION® esiRNA esiRNA human TFAP2E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178548 Rosetta Predictions human pricing
XM_233526 Rosetta Predictions rat pricing
XR_007665 Rosetta Predictions rat pricing
NM_198960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193637 predicted 1769
2 SASI_Hs01_00193638 predicted 737
3 SASI_Hs01_00193639 predicted 1613
4 SASI_Hs01_00193640 predicted 1015
5 SASI_Hs01_00193641 predicted 1174
6 SASI_Hs01_00193642 predicted 1740
7 SASI_Hs01_00193643 predicted 1452
8 SASI_Hs01_00193644 predicted 1365
9 SASI_Hs01_00193645 predicted 1067
10 SASI_Hs01_00193646 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387844 predicted 1147
2 SASI_Rn02_00387845 predicted 1157
3 SASI_Rn02_00387846 predicted 1656
4 SASI_Rn02_00387847 predicted 1279
5 SASI_Rn02_00387848 predicted 1565
6 SASI_Rn02_00387849 predicted 1398
7 SASI_Rn02_00387850 predicted 1016
8 SASI_Rn02_00387851 predicted 1521
9 SASI_Rn02_00387852 predicted 1861
10 SASI_Rn02_00387853 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00153817 predicted 1050
2 SASI_Rn02_00415154 predicted 1064
3 SASI_Rn02_00415155 predicted 1549
4 SASI_Rn01_00153819 predicted 1172
5 SASI_Rn01_00153820 predicted 1465
6 SASI_Rn01_00153822 predicted 1301
7 SASI_Rn01_00153824 predicted 918
8 SASI_Rn01_00153825 predicted 1419
9 SASI_Rn02_00415156 predicted 1760
10 SASI_Rn01_00153826 predicted 1279
11 SASI_Rn01_00153818 predicted 385
12 SASI_Rn01_00153821 predicted 1374
13 SASI_Rn01_00153823 predicted 672
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139378 predicted 1671
2 SASI_Mm01_00139379 predicted 1315
3 SASI_Mm01_00139380 predicted 773
4 SASI_Mm01_00139382 predicted 1868
5 SASI_Mm01_00139384 predicted 646
6 SASI_Mm01_00139385 predicted 1503
7 SASI_Mm01_00139383 predicted 1407
8 SASI_Mm01_00139386 predicted 1197
9 SASI_Mm02_00351246 predicted 781
10 SASI_Mm02_00351247 predicted 1881
11 SASI_Mm01_00139377 predicted 900
12 SASI_Mm01_00139381 predicted 1131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178548
TFAP2E MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-1092s21c1
Sequence:CCGGTGCTGACTTCGCTAGTGGAAGCTCGAGCTTCCACTAGCGAAGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178548.3-1731s21c1
Sequence:CCGGAGTTAAGGGCCCAGGTATTTGCTCGAGCAAATACCTGGGCCCTTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-1415s21c1
Sequence:CCGGACTGCCTTCCAGAACTATTTGCTCGAGCAAATAGTTCTGGAAGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-745s21c1
Sequence:CCGGCCTAGACCAGTCCGTGATCAACTCGAGTTGATCACGGACTGGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-1145s21c1
Sequence:CCGGTACGTCTGTGAGACGGAGTTCCTCGAGGAACTCCGTCTCACAGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178548.3-1613s21c1
Sequence:CCGGAGGACTGAAAGGTGGGATTAGCTCGAGCTAATCCCACCTTTCAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-1354s1c1
Sequence:CCGGCTTGACACACTTTAGCCTCATCTCGAGATGAGGCTAAAGTGTGTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-892s1c1
Sequence:CCGGCAGCTCAACGTCCAAGTACAACTCGAGTTGTACTTGGACGTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-1515s1c1
Sequence:CCGGAGGATGCCAAGCATCGGAAATCTCGAGATTTCCGATGCTTGGCATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-1033s1c1
Sequence:CCGGGTTAGAGAAGATTGGGCTCAACTCGAGTTGAGCCCAATCTTCTCTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178548
TFAP2E MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-1092s21c1
Sequence:CCGGTGCTGACTTCGCTAGTGGAAGCTCGAGCTTCCACTAGCGAAGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178548.3-1731s21c1
Sequence:CCGGAGTTAAGGGCCCAGGTATTTGCTCGAGCAAATACCTGGGCCCTTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-1415s21c1
Sequence:CCGGACTGCCTTCCAGAACTATTTGCTCGAGCAAATAGTTCTGGAAGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-745s21c1
Sequence:CCGGCCTAGACCAGTCCGTGATCAACTCGAGTTGATCACGGACTGGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-1145s21c1
Sequence:CCGGTACGTCTGTGAGACGGAGTTCCTCGAGGAACTCCGTCTCACAGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178548.3-1613s21c1
Sequence:CCGGAGGACTGAAAGGTGGGATTAGCTCGAGCTAATCCCACCTTTCAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-1354s1c1
Sequence:CCGGCTTGACACACTTTAGCCTCATCTCGAGATGAGGCTAAAGTGTGTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-892s1c1
Sequence:CCGGCAGCTCAACGTCCAAGTACAACTCGAGTTGTACTTGGACGTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-1515s1c1
Sequence:CCGGAGGATGCCAAGCATCGGAAATCTCGAGATTTCCGATGCTTGGCATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-1033s1c1
Sequence:CCGGGTTAGAGAAGATTGGGCTCAACTCGAGTTGAGCCCAATCTTCTCTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178548
TFAP2E MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-1092s21c1
Sequence:CCGGTGCTGACTTCGCTAGTGGAAGCTCGAGCTTCCACTAGCGAAGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178548.3-1731s21c1
Sequence:CCGGAGTTAAGGGCCCAGGTATTTGCTCGAGCAAATACCTGGGCCCTTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-1415s21c1
Sequence:CCGGACTGCCTTCCAGAACTATTTGCTCGAGCAAATAGTTCTGGAAGGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-745s21c1
Sequence:CCGGCCTAGACCAGTCCGTGATCAACTCGAGTTGATCACGGACTGGTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178548.3-1145s21c1
Sequence:CCGGTACGTCTGTGAGACGGAGTTCCTCGAGGAACTCCGTCTCACAGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178548.3-1613s21c1
Sequence:CCGGAGGACTGAAAGGTGGGATTAGCTCGAGCTAATCCCACCTTTCAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-1354s1c1
Sequence:CCGGCTTGACACACTTTAGCCTCATCTCGAGATGAGGCTAAAGTGTGTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-892s1c1
Sequence:CCGGCAGCTCAACGTCCAAGTACAACTCGAGTTGTACTTGGACGTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-1515s1c1
Sequence:CCGGAGGATGCCAAGCATCGGAAATCTCGAGATTTCCGATGCTTGGCATCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178548.2-1033s1c1
Sequence:CCGGGTTAGAGAAGATTGGGCTCAACTCGAGTTGAGCCCAATCTTCTCTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198960
TFAP2E MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000086223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198960.1-1562s1c1
Sequence:CCGGGATGGGACATAGTTGGGTAAACTCGAGTTTACCCAACTATGTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198960.1-799s1c1
Sequence:CCGGGCTCAGCTCAACATCCAAGTACTCGAGTACTTGGATGTTGAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198960.1-1041s1c1
Sequence:CCGGCTCGGGACTTTGGTTACGTTTCTCGAGAAACGTAACCAAAGTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198960.1-261s1c1
Sequence:CCGGCGGACTATCATCCTCCTTACTCTCGAGAGTAAGGAGGATGATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198960
TFAP2E MISSION shRNA shRNA Plasmid DNA
transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000086223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198960.1-1562s1c1
Sequence:CCGGGATGGGACATAGTTGGGTAAACTCGAGTTTACCCAACTATGTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198960.1-799s1c1
Sequence:CCGGGCTCAGCTCAACATCCAAGTACTCGAGTACTTGGATGTTGAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198960.1-1041s1c1
Sequence:CCGGCTCGGGACTTTGGTTACGTTTCTCGAGAAACGTAACCAAAGTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198960.1-261s1c1
Sequence:CCGGCGGACTATCATCCTCCTTACTCTCGAGAGTAAGGAGGATGATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198960
TFAP2E MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-2 epsilon (activating enhancer binding protein 2 epsilon)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000086223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198960.1-1562s1c1
Sequence:CCGGGATGGGACATAGTTGGGTAAACTCGAGTTTACCCAACTATGTCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198960.1-799s1c1
Sequence:CCGGGCTCAGCTCAACATCCAAGTACTCGAGTACTTGGATGTTGAGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198960.1-1041s1c1
Sequence:CCGGCTCGGGACTTTGGTTACGTTTCTCGAGAAACGTAACCAAAGTCCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198960.1-261s1c1
Sequence:CCGGCGGACTATCATCCTCCTTACTCTCGAGAGTAAGGAGGATGATAGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks