EMAIL THIS PAGE TO A FRIEND

TFAP4

transcription factor AP-4 (activating enhancer binding protein 4)

Synonyms: AP-4 bHLHc41
UniProtKB ID: Q01664, O60409
Gene ID:
Human(7023) Summary: Transcription factors of the basic helix-loop-helix-zipper (bHLH-ZIP) family contain a basic domain, which is used for DNA binding, and HLH and ZIP domains, which are used for oligomerization. Transcription factor AP4 activates both viral and cellular genes by binding to the symmetrical DNA sequence CAGCTG (Mermod et al., 1988 [PubMed 2833704]
Mouse(83383) transcription factor AP4
Rat(360482) transcription factor AP-4
Zebrafish(100318080) transcription factor AP-4 (activating enhancer binding protein 4)
chicken(430233) transcription factor AP-4 (activating enhancer binding protein 4)
dog(490029) transcription factor AP-4 (activating enhancer binding protein 4)
domestic cat(101095461) transcription factor AP-4 (activating enhancer binding protein 4)
naked mole-rat(101715683) transcription factor AP-4 (activating enhancer binding protein 4)
domestic guinea pig(100718065) transcription factor AP-4 (activating enhancer binding protein 4)
cow(540757) transcription factor AP-4 (activating enhancer binding protein 4)
sheep(101122654) transcription factor AP-4 (activating enhancer binding protein 4)
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV37416 Anti-TCFAP4 antibody produced in rabbit IgG fraction of antiserum canine, horse, human, bovine, mouse, guinea pig, rabbit, rat
western blot pricing
SAB2105356 Anti-TCFAP4 antibody produced in rabbit affinity isolated antibody horse, rabbit, mouse, guinea pig
western blot pricing
AV33435 Anti-TFAP4 (AB1) antibody produced in rabbit IgG fraction of antiserum mouse, canine, horse, rabbit, rat, human, guinea pig
immunohistochemistry, western blot pricing
AV33436 Anti-TFAP4 (AB2) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human, canine, bovine, rat, mouse
immunohistochemistry, western blot pricing
GW21438 Anti-TFAP4 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1412283 ANTI-TFAP4 antibody produced in mouse clone 8G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412649 ANTI-TFAP4 antibody produced in mouse clone 7C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2107902 Anti-TFAP4 antibody produced in rabbit IgG fraction of antiserum human, horse, guinea pig, bovine, rabbit, mouse, canine, rat
immunohistochemistry, western blot pricing
HPA001912 Anti-TFAP4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0007023M3 Monoclonal Anti-TFAP4 antibody produced in mouse clone 7A10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404461 Monoclonal Anti-TFAP4 antibody produced in mouse clone 6B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003223 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003223 Rosetta Predictions human pricing
NM_001108267 Rosetta Predictions rat pricing
NM_031182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173207 predicted 1331
2 SASI_Hs02_00335259 predicted 398
3 SASI_Hs01_00173208 predicted 447
4 SASI_Hs01_00173209 predicted 535
5 SASI_Hs01_00173210 predicted 439
6 SASI_Hs01_00173211 predicted 1372
7 SASI_Hs01_00173212 predicted 1333
8 SASI_Hs01_00173213 predicted 1372
9 SASI_Hs01_00173214 predicted 446
10 SASI_Hs01_00173215 predicted 1331
11 SASI_Hs01_00173206 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236974 predicted 643
2 SASI_Rn02_00236975 predicted 927
3 SASI_Rn02_00236976 predicted 643
4 SASI_Rn02_00236977 predicted 619
5 SASI_Rn02_00236978 predicted 958
6 SASI_Rn02_00236979 predicted 957
7 SASI_Rn02_00236980 predicted 662
8 SASI_Rn02_00236981 predicted 1259
9 SASI_Rn02_00236982 predicted 1007
10 SASI_Rn02_00236983 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337023 predicted 947
2 SASI_Mm01_00040141 predicted 645
3 SASI_Mm01_00040142 predicted 1273
4 SASI_Mm01_00040143 predicted 966
5 SASI_Mm01_00040145 predicted 923
6 SASI_Mm01_00040146 predicted 615
7 SASI_Mm01_00040147 predicted 266
8 SASI_Mm01_00040148 predicted 1078
9 SASI_Mm01_00040149 predicted 601
10 SASI_Mm02_00337024 predicted 959
11 SASI_Mm01_00040144 predicted 1072
12 SASI_Mm01_00040150 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003223
VALIDATED
TFAP4 MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-4 (activating enhancer binding protein 4)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003223.1-347s1c1
Sequence:CCGGGCCTTGCCAACATTCCACTAACTCGAGTTAGTGGAATGTTGGCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003223.1-441s1c1
Sequence:CCGGGCAGAGCATCAACGCGGGATTCTCGAGAATCCCGCGTTGATGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003223.1-996s1c1
Sequence:CCGGCCACATCAATGTCGTCACCATCTCGAGATGGTGACGACATTGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003223.1-1376s1c1
Sequence:CCGGCGATGTCATTTGGGTCTCTTTCTCGAGAAAGAGACCCAAATGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003223.1-1025s1c1
Sequence:CCGGCCTCGGTCATCAACTCTGTTTCTCGAGAAACAGAGTTGATGACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003223.2-523s21c1
Sequence:CCGGAGCAGACAGCCGAGTACATCTCTCGAGAGATGTACTCGGCTGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003223.2-584s21c1
Sequence:CCGGCACACAGCTCAAGCGCTTCATCTCGAGATGAAGCGCTTGAGCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003223
VALIDATED
TFAP4 MISSION shRNA shRNA Plasmid DNA
transcription factor AP-4 (activating enhancer binding protein 4)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003223.1-347s1c1
Sequence:CCGGGCCTTGCCAACATTCCACTAACTCGAGTTAGTGGAATGTTGGCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003223.1-441s1c1
Sequence:CCGGGCAGAGCATCAACGCGGGATTCTCGAGAATCCCGCGTTGATGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003223.1-996s1c1
Sequence:CCGGCCACATCAATGTCGTCACCATCTCGAGATGGTGACGACATTGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003223.1-1376s1c1
Sequence:CCGGCGATGTCATTTGGGTCTCTTTCTCGAGAAAGAGACCCAAATGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003223.1-1025s1c1
Sequence:CCGGCCTCGGTCATCAACTCTGTTTCTCGAGAAACAGAGTTGATGACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003223.2-523s21c1
Sequence:CCGGAGCAGACAGCCGAGTACATCTCTCGAGAGATGTACTCGGCTGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003223.2-584s21c1
Sequence:CCGGCACACAGCTCAAGCGCTTCATCTCGAGATGAAGCGCTTGAGCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003223
VALIDATED
TFAP4 MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-4 (activating enhancer binding protein 4)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003223.1-347s1c1
Sequence:CCGGGCCTTGCCAACATTCCACTAACTCGAGTTAGTGGAATGTTGGCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003223.1-441s1c1
Sequence:CCGGGCAGAGCATCAACGCGGGATTCTCGAGAATCCCGCGTTGATGCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003223.1-996s1c1
Sequence:CCGGCCACATCAATGTCGTCACCATCTCGAGATGGTGACGACATTGATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003223.1-1376s1c1
Sequence:CCGGCGATGTCATTTGGGTCTCTTTCTCGAGAAAGAGACCCAAATGACATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003223.1-1025s1c1
Sequence:CCGGCCTCGGTCATCAACTCTGTTTCTCGAGAAACAGAGTTGATGACCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003223.2-523s21c1
Sequence:CCGGAGCAGACAGCCGAGTACATCTCTCGAGAGATGTACTCGGCTGTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003223.2-584s21c1
Sequence:CCGGCACACAGCTCAAGCGCTTCATCTCGAGATGAAGCGCTTGAGCTGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031182
VALIDATED
TFAP4 MISSION shRNA Bacterial Glycerol Stock
transcription factor AP-4 (activating enhancer binding protein 4)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031182.1-1351s1c1
Sequence:CCGGCAATACTGTAAGTTGACCTTTCTCGAGAAAGGTCAACTTACAGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031182.1-1084s1c1
Sequence:CCGGCGAGCAGTTATCGTGAAGTCTCTCGAGAGACTTCACGATAACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031182.1-986s1c1
Sequence:CCGGCTGTCTCTACATCCCGGCAAACTCGAGTTTGCCGGGATGTAGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031182.1-438s1c1
Sequence:CCGGAGATGGAGAGAAGCTCAGCAACTCGAGTTGCTGAGCTTCTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031182.1-471s1c1
Sequence:CCGGCCAGCAGACAGCAGAATACATCTCGAGATGTATTCTGCTGTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031182.2-1074s21c1
Sequence:CCGGGGAACAGAGGCGAGCAGTTATCTCGAGATAACTGCTCGCCTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031182.2-535s21c1
Sequence:CCGGACACAGCTCAAGCGCTTTATCCTCGAGGATAAAGCGCTTGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031182.2-234s21c1
Sequence:CCGGGGTGCCCTCTTTGCAACATTTCTCGAGAAATGTTGCAAAGAGGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031182.2-1842s21c1
Sequence:CCGGCCTCCAGGGTTCCTGTTATTGCTCGAGCAATAACAGGAACCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031182.2-410s21c1
Sequence:CCGGAGTCCCTCAAGACCCTCATTCCTCGAGGAATGAGGGTCTTGAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031182
VALIDATED
TFAP4 MISSION shRNA shRNA Plasmid DNA
transcription factor AP-4 (activating enhancer binding protein 4)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031182.1-1351s1c1
Sequence:CCGGCAATACTGTAAGTTGACCTTTCTCGAGAAAGGTCAACTTACAGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031182.1-1084s1c1
Sequence:CCGGCGAGCAGTTATCGTGAAGTCTCTCGAGAGACTTCACGATAACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031182.1-986s1c1
Sequence:CCGGCTGTCTCTACATCCCGGCAAACTCGAGTTTGCCGGGATGTAGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031182.1-438s1c1
Sequence:CCGGAGATGGAGAGAAGCTCAGCAACTCGAGTTGCTGAGCTTCTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031182.1-471s1c1
Sequence:CCGGCCAGCAGACAGCAGAATACATCTCGAGATGTATTCTGCTGTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031182.2-1074s21c1
Sequence:CCGGGGAACAGAGGCGAGCAGTTATCTCGAGATAACTGCTCGCCTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031182.2-535s21c1
Sequence:CCGGACACAGCTCAAGCGCTTTATCCTCGAGGATAAAGCGCTTGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031182.2-234s21c1
Sequence:CCGGGGTGCCCTCTTTGCAACATTTCTCGAGAAATGTTGCAAAGAGGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031182.2-1842s21c1
Sequence:CCGGCCTCCAGGGTTCCTGTTATTGCTCGAGCAATAACAGGAACCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031182.2-410s21c1
Sequence:CCGGAGTCCCTCAAGACCCTCATTCCTCGAGGAATGAGGGTCTTGAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031182
VALIDATED
TFAP4 MISSION shRNA Lentiviral Transduction Particles
transcription factor AP-4 (activating enhancer binding protein 4)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031182.1-1351s1c1
Sequence:CCGGCAATACTGTAAGTTGACCTTTCTCGAGAAAGGTCAACTTACAGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031182.1-1084s1c1
Sequence:CCGGCGAGCAGTTATCGTGAAGTCTCTCGAGAGACTTCACGATAACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031182.1-986s1c1
Sequence:CCGGCTGTCTCTACATCCCGGCAAACTCGAGTTTGCCGGGATGTAGAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031182.1-438s1c1
Sequence:CCGGAGATGGAGAGAAGCTCAGCAACTCGAGTTGCTGAGCTTCTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031182.1-471s1c1
Sequence:CCGGCCAGCAGACAGCAGAATACATCTCGAGATGTATTCTGCTGTCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031182.2-1074s21c1
Sequence:CCGGGGAACAGAGGCGAGCAGTTATCTCGAGATAACTGCTCGCCTCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031182.2-535s21c1
Sequence:CCGGACACAGCTCAAGCGCTTTATCCTCGAGGATAAAGCGCTTGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031182.2-234s21c1
Sequence:CCGGGGTGCCCTCTTTGCAACATTTCTCGAGAAATGTTGCAAAGAGGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031182.2-1842s21c1
Sequence:CCGGCCTCCAGGGTTCCTGTTATTGCTCGAGCAATAACAGGAACCCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031182.2-410s21c1
Sequence:CCGGAGTCCCTCAAGACCCTCATTCCTCGAGGAATGAGGGTCTTGAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks