EMAIL THIS PAGE TO A FRIEND

TFB1M

transcription factor B1, mitochondrial

Synonyms: CGI75 mtTFB mtTFB1
UniProtKB ID: Q8WVM0, Q05DR0, Q9Y384
Gene ID:
Human(51106) Summary: The protein encoded by this gene is a dimethyltransferase that methylates the conserved stem loop of mitochondrial 12S rRNA. The encoded protein also is part of the basal mitochondrial transcription complex and is necessary for mitochondrial gene expression. The methylation and transcriptional activities of this protein are independent of one another. Variations in this gene may influence the severity of aminoglycoside-induced deafness (AID).[provided by RefSeq, Aug 2010]
Mouse(224481) transcription factor B1, mitochondrial
Rat(308140) transcription factor B1, mitochondrial
Zebrafish(767802) transcription factor B1, mitochondrial
dog(476253) transcription factor B1, mitochondrial
chicken(428608) transcription factor B1, mitochondrial
cow(533438) transcription factor B1, mitochondrial
domestic guinea pig(100715032) transcription factor B1, mitochondrial
naked mole-rat(101709903) transcription factor B1, mitochondrial
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501304 Anti-TFB1M (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine
ELISA, western blot pricing
SAB1407443 Anti-TFB1M antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2107914 Anti-TFB1M antibody produced in rabbit IgG fraction of antiserum canine, mouse, human, bovine, guinea pig, horse, rat, rabbit, zebrafish
western blot pricing
SAB2108232 Anti-TFB1M antibody produced in rabbit affinity isolated antibody human, canine, guinea pig, horse, pig, rabbit, bovine, zebrafish
western blot pricing
AV34544 Anti-TFB1M antibody produced in rabbit IgG fraction of antiserum, lyophilized powder canine, human, mouse, bovine, rat, chicken
western blot pricing
SAB2102409 Anti-TFB1M antibody produced in rabbit affinity isolated antibody, lyophilized powder , human, bovine, canine, rabbit, chicken, zebrafish, horse, pig
western blot pricing
HPA029428 Anti-TFB1M antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410899 Anti-TFB1M antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1402577 Monoclonal Anti-TFB1M antibody produced in mouse clone 4E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016020 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016020 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016020 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016020 Rosetta Predictions human pricing
NM_181474 Rosetta Predictions rat pricing
NM_146074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016020 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037929 predicted 339
2 SASI_Hs01_00037930 predicted 498
3 SASI_Hs01_00037931 predicted 389
4 SASI_Hs01_00037932 predicted 769
5 SASI_Hs01_00037933 predicted 210
6 SASI_Hs01_00037934 predicted 290
7 SASI_Hs01_00037935 predicted 635
8 SASI_Hs01_00037936 predicted 509
9 SASI_Hs01_00037938 predicted 323
10 SASI_Hs02_00348704 predicted 386
11 SASI_Hs01_00037937 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269746 predicted 297
2 SASI_Rn01_00074377 predicted 961
3 SASI_Rn01_00074378 predicted 771
4 SASI_Rn01_00074379 predicted 414
5 SASI_Rn01_00074380 predicted 946
6 SASI_Rn01_00074381 predicted 960
7 SASI_Rn02_00269747 predicted 980
8 SASI_Rn01_00074383 predicted 949
9 SASI_Rn01_00074384 predicted 768
10 SASI_Rn01_00074385 predicted 461
11 SASI_Rn01_00074376 predicted 856
12 SASI_Rn01_00074382 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176910 predicted 1012
2 SASI_Mm01_00176911 predicted 934
3 SASI_Mm01_00176912 predicted 325
4 SASI_Mm01_00176914 predicted 305
5 SASI_Mm01_00176915 predicted 430
6 SASI_Mm02_00341703 predicted 945
7 SASI_Mm01_00176916 predicted 930
8 SASI_Mm02_00341704 predicted 327
9 SASI_Mm02_00341705 predicted 752
10 SASI_Mm01_00176919 predicted 393
11 SASI_Mm01_00176913 predicted 718
12 SASI_Mm01_00176917 predicted 846
13 SASI_Mm01_00176918 predicted 711
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016020
VALIDATED
TFB1M MISSION shRNA Bacterial Glycerol Stock
transcription factor B1, mitochondrial
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-190s21c1
Sequence:CCGGGCTGACAGATAAGATTGTAAGCTCGAGCTTACAATCTTATCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-675s21c1
Sequence:CCGGGCAATGTTCGACACATCTTTACTCGAGTAAAGATGTGTCGAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-461s21c1
Sequence:CCGGCCTCCAAATGTACATATTATTCTCGAGAATAATATGTACATTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-154s21c1
Sequence:CCGGGAAGCAGCTATCACAGAATTTCTCGAGAAATTCTGTGATAGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016020.1-922s1c1
Sequence:CCGGGCAGACATAGACCCTACTCTTCTCGAGAAGAGTAGGGTCTATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016020.1-1092s1c1
Sequence:CCGGCGCAGAGAATTACAGACTCTACTCGAGTAGAGTCTGTAATTCTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016020.1-119s1c1
Sequence:CCGGCCACGATTCGAGAAATCATTACTCGAGTAATGATTTCTCGAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016020.1-307s1c1
Sequence:CCGGGCTGAACTTCTGGTGGTTGAACTCGAGTTCAACCACCAGAAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016020.1-1015s1c1
Sequence:CCGGCCACAACTCTTTGCATATAATCTCGAGATTATATGCAAAGAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016020
VALIDATED
TFB1M MISSION shRNA shRNA Plasmid DNA
transcription factor B1, mitochondrial
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-190s21c1
Sequence:CCGGGCTGACAGATAAGATTGTAAGCTCGAGCTTACAATCTTATCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-675s21c1
Sequence:CCGGGCAATGTTCGACACATCTTTACTCGAGTAAAGATGTGTCGAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-461s21c1
Sequence:CCGGCCTCCAAATGTACATATTATTCTCGAGAATAATATGTACATTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-154s21c1
Sequence:CCGGGAAGCAGCTATCACAGAATTTCTCGAGAAATTCTGTGATAGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016020.1-922s1c1
Sequence:CCGGGCAGACATAGACCCTACTCTTCTCGAGAAGAGTAGGGTCTATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016020.1-1092s1c1
Sequence:CCGGCGCAGAGAATTACAGACTCTACTCGAGTAGAGTCTGTAATTCTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016020.1-119s1c1
Sequence:CCGGCCACGATTCGAGAAATCATTACTCGAGTAATGATTTCTCGAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016020.1-307s1c1
Sequence:CCGGGCTGAACTTCTGGTGGTTGAACTCGAGTTCAACCACCAGAAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016020.1-1015s1c1
Sequence:CCGGCCACAACTCTTTGCATATAATCTCGAGATTATATGCAAAGAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016020
VALIDATED
TFB1M MISSION shRNA Lentiviral Transduction Particles
transcription factor B1, mitochondrial
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-190s21c1
Sequence:CCGGGCTGACAGATAAGATTGTAAGCTCGAGCTTACAATCTTATCTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-675s21c1
Sequence:CCGGGCAATGTTCGACACATCTTTACTCGAGTAAAGATGTGTCGAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-461s21c1
Sequence:CCGGCCTCCAAATGTACATATTATTCTCGAGAATAATATGTACATTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016020.2-154s21c1
Sequence:CCGGGAAGCAGCTATCACAGAATTTCTCGAGAAATTCTGTGATAGCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_016020.1-922s1c1
Sequence:CCGGGCAGACATAGACCCTACTCTTCTCGAGAAGAGTAGGGTCTATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016020.1-1092s1c1
Sequence:CCGGCGCAGAGAATTACAGACTCTACTCGAGTAGAGTCTGTAATTCTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016020.1-119s1c1
Sequence:CCGGCCACGATTCGAGAAATCATTACTCGAGTAATGATTTCTCGAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016020.1-307s1c1
Sequence:CCGGGCTGAACTTCTGGTGGTTGAACTCGAGTTCAACCACCAGAAGTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016020.1-1015s1c1
Sequence:CCGGCCACAACTCTTTGCATATAATCTCGAGATTATATGCAAAGAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146074
VALIDATED
TFB1M MISSION shRNA Bacterial Glycerol Stock
transcription factor B1, mitochondrial
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146074.1-624s21c1
Sequence:CCGGCCTCTTTACAATCCCAGGAAACTCGAGTTTCCTGGGATTGTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146074.1-152s21c1
Sequence:CCGGCTGGCAGTCTAGCAGATGTTTCTCGAGAAACATCTGCTAGACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146074.1-1147s21c1
Sequence:CCGGCGTGACTTTACTATCCAGCTTCTCGAGAAGCTGGATAGTAAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146074.1-488s21c1
Sequence:CCGGGCCCTTTCGTTTATGGCAGAACTCGAGTTCTGCCATAAACGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146074.1-1147s1c1
Sequence:CCGGCGTGACTTTACTATCCAGCTTCTCGAGAAGCTGGATAGTAAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146074.1-624s1c1
Sequence:CCGGCCTCTTTACAATCCCAGGAAACTCGAGTTTCCTGGGATTGTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146074.1-152s1c1
Sequence:CCGGCTGGCAGTCTAGCAGATGTTTCTCGAGAAACATCTGCTAGACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146074.1-488s1c1
Sequence:CCGGGCCCTTTCGTTTATGGCAGAACTCGAGTTCTGCCATAAACGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146074.1-262s1c1
Sequence:CCGGACTCGCTTTATCCCAGGGTTACTCGAGTAACCCTGGGATAAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146074
VALIDATED
TFB1M MISSION shRNA shRNA Plasmid DNA
transcription factor B1, mitochondrial
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146074.1-624s21c1
Sequence:CCGGCCTCTTTACAATCCCAGGAAACTCGAGTTTCCTGGGATTGTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146074.1-152s21c1
Sequence:CCGGCTGGCAGTCTAGCAGATGTTTCTCGAGAAACATCTGCTAGACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146074.1-1147s21c1
Sequence:CCGGCGTGACTTTACTATCCAGCTTCTCGAGAAGCTGGATAGTAAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146074.1-488s21c1
Sequence:CCGGGCCCTTTCGTTTATGGCAGAACTCGAGTTCTGCCATAAACGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146074.1-1147s1c1
Sequence:CCGGCGTGACTTTACTATCCAGCTTCTCGAGAAGCTGGATAGTAAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146074.1-624s1c1
Sequence:CCGGCCTCTTTACAATCCCAGGAAACTCGAGTTTCCTGGGATTGTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146074.1-152s1c1
Sequence:CCGGCTGGCAGTCTAGCAGATGTTTCTCGAGAAACATCTGCTAGACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146074.1-488s1c1
Sequence:CCGGGCCCTTTCGTTTATGGCAGAACTCGAGTTCTGCCATAAACGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146074.1-262s1c1
Sequence:CCGGACTCGCTTTATCCCAGGGTTACTCGAGTAACCCTGGGATAAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146074
VALIDATED
TFB1M MISSION shRNA Lentiviral Transduction Particles
transcription factor B1, mitochondrial
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146074.1-624s21c1
Sequence:CCGGCCTCTTTACAATCCCAGGAAACTCGAGTTTCCTGGGATTGTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146074.1-152s21c1
Sequence:CCGGCTGGCAGTCTAGCAGATGTTTCTCGAGAAACATCTGCTAGACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146074.1-1147s21c1
Sequence:CCGGCGTGACTTTACTATCCAGCTTCTCGAGAAGCTGGATAGTAAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146074.1-488s21c1
Sequence:CCGGGCCCTTTCGTTTATGGCAGAACTCGAGTTCTGCCATAAACGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146074.1-1147s1c1
Sequence:CCGGCGTGACTTTACTATCCAGCTTCTCGAGAAGCTGGATAGTAAAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146074.1-624s1c1
Sequence:CCGGCCTCTTTACAATCCCAGGAAACTCGAGTTTCCTGGGATTGTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146074.1-152s1c1
Sequence:CCGGCTGGCAGTCTAGCAGATGTTTCTCGAGAAACATCTGCTAGACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146074.1-488s1c1
Sequence:CCGGGCCCTTTCGTTTATGGCAGAACTCGAGTTCTGCCATAAACGAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146074.1-262s1c1
Sequence:CCGGACTCGCTTTATCCCAGGGTTACTCGAGTAACCCTGGGATAAAGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks