EMAIL THIS PAGE TO A FRIEND

TFB2M

transcription factor B2, mitochondrial

Synonyms: Hkp1 mtTFB2
UniProtKB ID: Q9H5Q4, Q9H626
Gene ID:
Mouse(15278) transcription factor B2, mitochondrial
Rat(289307) transcription factor B2, mitochondrial
naked mole-rat(101721509) transcription factor B2, mitochondrial
domestic guinea pig(100726959) transcription factor B2, mitochondrial
cow(516874) transcription factor B2, mitochondrial
sheep(101115889) transcription factor B2, mitochondrial
Zebrafish(569468) transcription factor B2, mitochondrial
domestic cat(101090578) transcription factor B2, mitochondrial
chicken(421488) transcription factor B2, mitochondrial
dog(480102) transcription factor B2, mitochondrial
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW21225 Anti-HKP1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
AV34471 Anti-TFB2M (AB1) antibody produced in rabbit IgG fraction of antiserum horse, human, rabbit, rat
immunohistochemistry, western blot pricing
AV39550 Anti-TFB2M (AB2) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2501690 Anti-TFB2M (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunocytochemistry pricing
SAB2501691 Anti-Tfb2m antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat
ELISA, western blot pricing
SAB2501693 Anti-TFB2M antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1407865 Anti-TFB2M antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108360 Anti-TFB2M antibody produced in rabbit affinity isolated antibody human
western blot pricing
HPA030265 Anti-TFB2M antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA028482 Anti-TFB2M antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA061095 Anti-TFB2M antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB2105429 Anti-TFB2M, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder human
western blot pricing
SAB1402620 Monoclonal Anti-TFB2M, (C-terminal) antibody produced in mouse clone 2E10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022366 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022366 Rosetta Predictions human pricing
NM_001008293 Rosetta Predictions rat pricing
XM_001060168 Rosetta Predictions rat pricing
XM_001060217 Rosetta Predictions rat pricing
NM_008249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022366 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014363 predicted 787
2 SASI_Hs01_00014364 predicted 324
3 SASI_Hs01_00014365 predicted 1050
4 SASI_Hs01_00014366 predicted 317
5 SASI_Hs02_00355664 predicted 891
6 SASI_Hs01_00014368 predicted 1274
7 SASI_Hs02_00355665 predicted 1125
8 SASI_Hs02_00355666 predicted 1259
9 SASI_Hs01_00014370 predicted 1155
10 SASI_Hs01_00014372 predicted 1049
11 SASI_Hs01_00014367 predicted 883
12 SASI_Hs01_00014369 predicted 979
13 SASI_Hs01_00014371 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112122 predicted 890
2 SASI_Rn01_00112123 predicted 1026
3 SASI_Rn02_00198998 predicted 677
4 SASI_Rn01_00112124 predicted 1013
5 SASI_Rn01_00112125 predicted 383
6 SASI_Rn01_00112126 predicted 731
7 SASI_Rn01_00112127 predicted 1092
8 SASI_Rn01_00112128 predicted 482
9 SASI_Rn01_00112129 predicted 706
10 SASI_Rn01_00112130 predicted 855
11 SASI_Rn01_00112131 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295571 predicted 586
2 SASI_Rn02_00295572 predicted 685
3 SASI_Rn02_00295573 predicted 726
4 SASI_Rn02_00295574 predicted 390
5 SASI_Rn02_00295575 predicted 504
6 SASI_Rn02_00295576 predicted 486
7 SASI_Rn02_00295577 predicted 711
8 SASI_Rn02_00295578 predicted 392
9 SASI_Rn02_00295579 predicted 204
10 SASI_Rn02_00295580 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295742 predicted 898
2 SASI_Rn02_00295743 predicted 1034
3 SASI_Rn02_00295744 predicted 678
4 SASI_Rn02_00295745 predicted 1027
5 SASI_Rn02_00295746 predicted 394
6 SASI_Rn02_00295747 predicted 742
7 SASI_Rn02_00295748 predicted 807
8 SASI_Rn02_00295749 predicted 1104
9 SASI_Rn02_00295750 predicted 482
10 SASI_Rn02_00295751 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126569 predicted 1214
2 SASI_Mm02_00313441 predicted 287
3 SASI_Mm01_00126573 predicted 435
4 SASI_Mm02_00313442 predicted 1218
5 SASI_Mm02_00313443 predicted 417
6 SASI_Mm02_00313444 predicted 361
7 SASI_Mm01_00126571 predicted 1376
8 SASI_Mm01_00126570 predicted 1069
9 SASI_Mm01_00126572 predicted 801
10 SASI_Mm01_00126574 predicted 781
11 SASI_Mm01_00126575 predicted 762
12 SASI_Mm01_00126576 predicted 602
13 SASI_Mm01_00126577 predicted 1138
14 SASI_Mm01_00126578 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022366
VALIDATED
TFB2M MISSION shRNA Bacterial Glycerol Stock
transcription factor B2, mitochondrial
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-1476s1c1
Sequence:CCGGGATGAAACAGTGTCTGCTATTCTCGAGAATAGCAGACACTGTTTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-1164s1c1
Sequence:CCGGCGAGAGATATATTGATGCAAACTCGAGTTTGCATCAATATATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-970s1c1
Sequence:CCGGCCCAAAGCGTAGGGAATTATTCTCGAGAATAATTCCCTACGCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-1120s1c1
Sequence:CCGGCGCCACTGTAATAGACCACTTCTCGAGAAGTGGTCTATTACAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-854s1c1
Sequence:CCGGCCAGACTTGTATCATGTATTACTCGAGTAATACATGATACAAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_022366.2-971s21c1
Sequence:CCGGCCCAAAGCGTAGGGAATTATTCTCGAGAATAATTCCCTACGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022366.2-1121s21c1
Sequence:CCGGCGCCACTGTAATAGACCACTTCTCGAGAAGTGGTCTATTACAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_022366.2-855s21c1
Sequence:CCGGCCAGACTTGTATCATGTATTACTCGAGTAATACATGATACAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_022366.2-1477s21c1
Sequence:CCGGGATGAAACAGTGTCTGCTATTCTCGAGAATAGCAGACACTGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022366
VALIDATED
TFB2M MISSION shRNA shRNA Plasmid DNA
transcription factor B2, mitochondrial
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-1476s1c1
Sequence:CCGGGATGAAACAGTGTCTGCTATTCTCGAGAATAGCAGACACTGTTTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-1164s1c1
Sequence:CCGGCGAGAGATATATTGATGCAAACTCGAGTTTGCATCAATATATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-970s1c1
Sequence:CCGGCCCAAAGCGTAGGGAATTATTCTCGAGAATAATTCCCTACGCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-1120s1c1
Sequence:CCGGCGCCACTGTAATAGACCACTTCTCGAGAAGTGGTCTATTACAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-854s1c1
Sequence:CCGGCCAGACTTGTATCATGTATTACTCGAGTAATACATGATACAAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_022366.2-971s21c1
Sequence:CCGGCCCAAAGCGTAGGGAATTATTCTCGAGAATAATTCCCTACGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022366.2-1121s21c1
Sequence:CCGGCGCCACTGTAATAGACCACTTCTCGAGAAGTGGTCTATTACAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_022366.2-855s21c1
Sequence:CCGGCCAGACTTGTATCATGTATTACTCGAGTAATACATGATACAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_022366.2-1477s21c1
Sequence:CCGGGATGAAACAGTGTCTGCTATTCTCGAGAATAGCAGACACTGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022366
VALIDATED
TFB2M MISSION shRNA Lentiviral Transduction Particles
transcription factor B2, mitochondrial
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021054    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-1476s1c1
Sequence:CCGGGATGAAACAGTGTCTGCTATTCTCGAGAATAGCAGACACTGTTTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-1164s1c1
Sequence:CCGGCGAGAGATATATTGATGCAAACTCGAGTTTGCATCAATATATCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-970s1c1
Sequence:CCGGCCCAAAGCGTAGGGAATTATTCTCGAGAATAATTCCCTACGCTTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-1120s1c1
Sequence:CCGGCGCCACTGTAATAGACCACTTCTCGAGAAGTGGTCTATTACAGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_022366.1-854s1c1
Sequence:CCGGCCAGACTTGTATCATGTATTACTCGAGTAATACATGATACAAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_022366.2-971s21c1
Sequence:CCGGCCCAAAGCGTAGGGAATTATTCTCGAGAATAATTCCCTACGCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022366.2-1121s21c1
Sequence:CCGGCGCCACTGTAATAGACCACTTCTCGAGAAGTGGTCTATTACAGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_022366.2-855s21c1
Sequence:CCGGCCAGACTTGTATCATGTATTACTCGAGTAATACATGATACAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318821    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_022366.2-1477s21c1
Sequence:CCGGGATGAAACAGTGTCTGCTATTCTCGAGAATAGCAGACACTGTTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008249
VALIDATED
TFB2M MISSION shRNA Bacterial Glycerol Stock
transcription factor B2, mitochondrial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008249.1-1899s1c1
Sequence:CCGGGCCATCTTGTAATGGCGTTTACTCGAGTAAACGCCATTACAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-209s1c1
Sequence:CCGGGCGGCTTCTCTGACTTCAATACTCGAGTATTGAAGTCAGAGAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-300s1c1
Sequence:CCGGGCGTCACATAGCATGTAAGAACTCGAGTTCTTACATGCTATGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-991s1c1
Sequence:CCGGCGTAGGACTTTATTTACAGAACTCGAGTTCTGTAAATAAAGTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-745s1c1
Sequence:CCGGCGAGTAGAACTGAATATGTTTCTCGAGAAACATATTCAGTTCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008249.4-1157s21c1
Sequence:CCGGAGTACGGTTGATCCTATTAATCTCGAGATTAATAGGATCAACCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-1354s21c1
Sequence:CCGGTGGAGCTGTTTGTCCATTATTCTCGAGAATAATGGACAAACAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-258s21c1
Sequence:CCGGGCGGCTTCTCTGACTTCAATACTCGAGTATTGAAGTCAGAGAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-349s21c1
Sequence:CCGGGCGTCACATAGCATGTAAGAACTCGAGTTCTTACATGCTATGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-794s21c1
Sequence:CCGGCGAGTAGAACTGAATATGTTTCTCGAGAAACATATTCAGTTCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008249
VALIDATED
TFB2M MISSION shRNA shRNA Plasmid DNA
transcription factor B2, mitochondrial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008249.1-1899s1c1
Sequence:CCGGGCCATCTTGTAATGGCGTTTACTCGAGTAAACGCCATTACAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-209s1c1
Sequence:CCGGGCGGCTTCTCTGACTTCAATACTCGAGTATTGAAGTCAGAGAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-300s1c1
Sequence:CCGGGCGTCACATAGCATGTAAGAACTCGAGTTCTTACATGCTATGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-991s1c1
Sequence:CCGGCGTAGGACTTTATTTACAGAACTCGAGTTCTGTAAATAAAGTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-745s1c1
Sequence:CCGGCGAGTAGAACTGAATATGTTTCTCGAGAAACATATTCAGTTCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008249.4-1157s21c1
Sequence:CCGGAGTACGGTTGATCCTATTAATCTCGAGATTAATAGGATCAACCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-1354s21c1
Sequence:CCGGTGGAGCTGTTTGTCCATTATTCTCGAGAATAATGGACAAACAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-258s21c1
Sequence:CCGGGCGGCTTCTCTGACTTCAATACTCGAGTATTGAAGTCAGAGAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-349s21c1
Sequence:CCGGGCGTCACATAGCATGTAAGAACTCGAGTTCTTACATGCTATGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-794s21c1
Sequence:CCGGCGAGTAGAACTGAATATGTTTCTCGAGAAACATATTCAGTTCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008249
VALIDATED
TFB2M MISSION shRNA Lentiviral Transduction Particles
transcription factor B2, mitochondrial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008249.1-1899s1c1
Sequence:CCGGGCCATCTTGTAATGGCGTTTACTCGAGTAAACGCCATTACAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-209s1c1
Sequence:CCGGGCGGCTTCTCTGACTTCAATACTCGAGTATTGAAGTCAGAGAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-300s1c1
Sequence:CCGGGCGTCACATAGCATGTAAGAACTCGAGTTCTTACATGCTATGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-991s1c1
Sequence:CCGGCGTAGGACTTTATTTACAGAACTCGAGTTCTGTAAATAAAGTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008249.1-745s1c1
Sequence:CCGGCGAGTAGAACTGAATATGTTTCTCGAGAAACATATTCAGTTCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008249.4-1157s21c1
Sequence:CCGGAGTACGGTTGATCCTATTAATCTCGAGATTAATAGGATCAACCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337791    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-1354s21c1
Sequence:CCGGTGGAGCTGTTTGTCCATTATTCTCGAGAATAATGGACAAACAGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-258s21c1
Sequence:CCGGGCGGCTTCTCTGACTTCAATACTCGAGTATTGAAGTCAGAGAAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-349s21c1
Sequence:CCGGGCGTCACATAGCATGTAAGAACTCGAGTTCTTACATGCTATGTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008249.4-794s21c1
Sequence:CCGGCGAGTAGAACTGAATATGTTTCTCGAGAAACATATTCAGTTCTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks