EMAIL THIS PAGE TO A FRIEND

TFCP2

transcription factor CP2

Synonyms: LBP1C LSF LSF1D SEF TFCP2C
UniProtKB ID: Q12800, A8K5E9, Q12801, Q9UD75, Q9UD77
Gene ID:
Human(7024) Summary: This gene encodes a transcription factor that binds the alpha-globin promoter and activates transcription of the alpha-globin gene. The encoded protein regulates erythroid gene expression, plays a role in the transcriptional switch of globin gene promoters, and it activates many other cellular and viral gene promoters. The gene product interacts with certain inflammatory response factors, and polymorphisms of this gene may be involved in the pathogenesis of Alzheimer's disease. [provided by RefSeq, Mar 2010]
Mouse(21422) transcription factor CP2
Rat(315309) transcription factor CP2
Zebrafish(100001906) transcription factor CP2
dog(477607) transcription factor CP2
domestic cat(101090779) transcription factor CP2
Horse(100052504) transcription factor CP2
chicken(378900) transcription factor CP2
cow(509448) transcription factor CP2
sheep(101115865) transcription factor CP2
domestic guinea pig(100718239) transcription factor CP2
naked mole-rat(101718285) transcription factor CP2
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005653 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005653 Rosetta Predictions human pricing
NM_001134714 Rosetta Predictions rat pricing
XM_235662 Rosetta Predictions rat pricing
NM_033476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128371 predicted 740
2 SASI_Hs01_00128372 predicted 1253
3 SASI_Hs01_00128373 predicted 614
4 SASI_Hs01_00128374 predicted 2036
5 SASI_Hs01_00128375 predicted 943
6 SASI_Hs01_00128376 predicted 2053
7 SASI_Hs01_00128378 predicted 1936
8 SASI_Hs01_00128379 predicted 1221
9 SASI_Hs01_00128380 predicted 720
10 SASI_Hs02_00340022 predicted 761
11 SASI_Hs01_00128377 predicted 1084
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258134 predicted 1747
2 SASI_Rn02_00258135 predicted 654
3 SASI_Rn02_00258136 predicted 861
4 SASI_Rn02_00258137 predicted 612
5 SASI_Rn02_00258138 predicted 1042
6 SASI_Rn02_00258139 predicted 430
7 SASI_Rn02_00258140 predicted 585
8 SASI_Rn02_00258141 predicted 1404
9 SASI_Rn02_00258142 predicted 1800
10 SASI_Rn02_00258143 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178381 predicted 1313
2 SASI_Rn01_00178382 predicted 391
3 SASI_Rn01_00178383 predicted 605
4 SASI_Rn01_00178384 predicted 850
5 SASI_Rn01_00178385 predicted 788
6 SASI_Rn01_00178386 predicted 327
7 SASI_Rn01_00178387 predicted 1318
8 SASI_Rn01_00178388 predicted 346
9 SASI_Rn01_00178389 predicted 394
10 SASI_Rn01_00178390 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337362 predicted 868
2 SASI_Mm02_00337363 predicted 231
3 SASI_Mm02_00337364 predicted 356
4 SASI_Mm02_00337365 predicted 908
5 SASI_Mm02_00337366 predicted 512
6 SASI_Mm02_00337367 predicted 916
7 SASI_Mm02_00337368 predicted 357
8 SASI_Mm02_00337369 predicted 348
9 SASI_Mm02_00337370 predicted 1911
10 SASI_Mm02_00337371 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005653
VALIDATED
TFCP2 MISSION shRNA Bacterial Glycerol Stock
transcription factor CP2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005653.3-2141s21c1
Sequence:CCGGGCTCTTGTGGTACACACAGATCTCGAGATCTGTGTGTACCACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005653.3-1733s21c1
Sequence:CCGGTCGTTTACCATGCTATCTATCCTCGAGGATAGATAGCATGGTAAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005653.3-951s21c1
Sequence:CCGGGGCTAATCCAACTCAACTAAACTCGAGTTTAGTTGAGTTGGATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005653.3-1258s21c1
Sequence:CCGGCCTTCCTATGAGACAACCATACTCGAGTATGGTTGTCTCATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005653.3-921s21c1
Sequence:CCGGCCCGATGTCTGTGGGTATAATCTCGAGATTATACCCACAGACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-2141s1c1
Sequence:CCGGGCTCTTGTGGTACACACAGATCTCGAGATCTGTGTGTACCACAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005653.3-751s1c1
Sequence:CCGGCGAATGCTAGACAATAGGAAACTCGAGTTTCCTATTGTCTAGCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-1086s1c1
Sequence:CCGGCCGAGTACAAATAGATACCTTCTCGAGAAGGTATCTATTTGTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-1258s1c1
Sequence:CCGGCCTTCCTATGAGACAACCATACTCGAGTATGGTTGTCTCATAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-1026s1c1
Sequence:CCGGGCACTGTATTAGCACAGAGTTCTCGAGAACTCTGTGCTAATACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005653
VALIDATED
TFCP2 MISSION shRNA shRNA Plasmid DNA
transcription factor CP2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005653.3-2141s21c1
Sequence:CCGGGCTCTTGTGGTACACACAGATCTCGAGATCTGTGTGTACCACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005653.3-1733s21c1
Sequence:CCGGTCGTTTACCATGCTATCTATCCTCGAGGATAGATAGCATGGTAAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005653.3-951s21c1
Sequence:CCGGGGCTAATCCAACTCAACTAAACTCGAGTTTAGTTGAGTTGGATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005653.3-1258s21c1
Sequence:CCGGCCTTCCTATGAGACAACCATACTCGAGTATGGTTGTCTCATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005653.3-921s21c1
Sequence:CCGGCCCGATGTCTGTGGGTATAATCTCGAGATTATACCCACAGACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-2141s1c1
Sequence:CCGGGCTCTTGTGGTACACACAGATCTCGAGATCTGTGTGTACCACAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005653.3-751s1c1
Sequence:CCGGCGAATGCTAGACAATAGGAAACTCGAGTTTCCTATTGTCTAGCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-1086s1c1
Sequence:CCGGCCGAGTACAAATAGATACCTTCTCGAGAAGGTATCTATTTGTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-1258s1c1
Sequence:CCGGCCTTCCTATGAGACAACCATACTCGAGTATGGTTGTCTCATAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-1026s1c1
Sequence:CCGGGCACTGTATTAGCACAGAGTTCTCGAGAACTCTGTGCTAATACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005653
VALIDATED
TFCP2 MISSION shRNA Lentiviral Transduction Particles
transcription factor CP2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274225    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005653.3-2141s21c1
Sequence:CCGGGCTCTTGTGGTACACACAGATCTCGAGATCTGTGTGTACCACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005653.3-1733s21c1
Sequence:CCGGTCGTTTACCATGCTATCTATCCTCGAGGATAGATAGCATGGTAAACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_005653.3-951s21c1
Sequence:CCGGGGCTAATCCAACTCAACTAAACTCGAGTTTAGTTGAGTTGGATTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005653.3-1258s21c1
Sequence:CCGGCCTTCCTATGAGACAACCATACTCGAGTATGGTTGTCTCATAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_005653.3-921s21c1
Sequence:CCGGCCCGATGTCTGTGGGTATAATCTCGAGATTATACCCACAGACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-2141s1c1
Sequence:CCGGGCTCTTGTGGTACACACAGATCTCGAGATCTGTGTGTACCACAAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005653.3-751s1c1
Sequence:CCGGCGAATGCTAGACAATAGGAAACTCGAGTTTCCTATTGTCTAGCATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-1086s1c1
Sequence:CCGGCCGAGTACAAATAGATACCTTCTCGAGAAGGTATCTATTTGTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-1258s1c1
Sequence:CCGGCCTTCCTATGAGACAACCATACTCGAGTATGGTTGTCTCATAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005653.3-1026s1c1
Sequence:CCGGGCACTGTATTAGCACAGAGTTCTCGAGAACTCTGTGCTAATACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033476
VALIDATED
TFCP2 MISSION shRNA Bacterial Glycerol Stock
transcription factor CP2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-246s21c1
Sequence:CCGGCCGATAATGAGAACGAGATTCCTCGAGGAATCTCGTTCTCATTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-2529s21c1
Sequence:CCGGCCTTACCACTGTAGCGATAATCTCGAGATTATCGCTACAGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-918s21c1
Sequence:GTACCGGAGATCACCTACGTCAACAATTCTCGAGAATTGTTGACGTAGGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-514s21c1
Sequence:GTACCGGCAGGATTCTCGACATAGATATCTCGAGATATCTATGTCGAGAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-1231s21c1
Sequence:CCGGGCGGCCAAGGCTAACCATTTACTCGAGTAAATGGTTAGCCTTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033476.1-872s1c1
Sequence:CCGGCCTTCTTATGAGACAACCATACTCGAGTATGGTTGTCTCATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033476.1-1815s1c1
Sequence:CCGGCCCTGTTGATACCAGTAAGAACTCGAGTTCTTACTGGTATCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033476.1-1518s1c1
Sequence:CCGGCCTGCTTTATTCTGGACACGACTCGAGTCGTGTCCAGAATAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033476.1-1187s1c1
Sequence:CCGGGCAGATGGAATCAGACTCTTTCTCGAGAAAGAGTCTGATTCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033476
VALIDATED
TFCP2 MISSION shRNA shRNA Plasmid DNA
transcription factor CP2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-246s21c1
Sequence:CCGGCCGATAATGAGAACGAGATTCCTCGAGGAATCTCGTTCTCATTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-2529s21c1
Sequence:CCGGCCTTACCACTGTAGCGATAATCTCGAGATTATCGCTACAGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-918s21c1
Sequence:GTACCGGAGATCACCTACGTCAACAATTCTCGAGAATTGTTGACGTAGGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-514s21c1
Sequence:GTACCGGCAGGATTCTCGACATAGATATCTCGAGATATCTATGTCGAGAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-1231s21c1
Sequence:CCGGGCGGCCAAGGCTAACCATTTACTCGAGTAAATGGTTAGCCTTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033476.1-872s1c1
Sequence:CCGGCCTTCTTATGAGACAACCATACTCGAGTATGGTTGTCTCATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033476.1-1815s1c1
Sequence:CCGGCCCTGTTGATACCAGTAAGAACTCGAGTTCTTACTGGTATCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033476.1-1518s1c1
Sequence:CCGGCCTGCTTTATTCTGGACACGACTCGAGTCGTGTCCAGAATAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033476.1-1187s1c1
Sequence:CCGGGCAGATGGAATCAGACTCTTTCTCGAGAAAGAGTCTGATTCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033476
VALIDATED
TFCP2 MISSION shRNA Lentiviral Transduction Particles
transcription factor CP2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-246s21c1
Sequence:CCGGCCGATAATGAGAACGAGATTCCTCGAGGAATCTCGTTCTCATTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-2529s21c1
Sequence:CCGGCCTTACCACTGTAGCGATAATCTCGAGATTATCGCTACAGTGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-918s21c1
Sequence:GTACCGGAGATCACCTACGTCAACAATTCTCGAGAATTGTTGACGTAGGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-514s21c1
Sequence:GTACCGGCAGGATTCTCGACATAGATATCTCGAGATATCTATGTCGAGAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033476.2-1231s21c1
Sequence:CCGGGCGGCCAAGGCTAACCATTTACTCGAGTAAATGGTTAGCCTTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033476.1-872s1c1
Sequence:CCGGCCTTCTTATGAGACAACCATACTCGAGTATGGTTGTCTCATAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033476.1-1815s1c1
Sequence:CCGGCCCTGTTGATACCAGTAAGAACTCGAGTTCTTACTGGTATCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033476.1-1518s1c1
Sequence:CCGGCCTGCTTTATTCTGGACACGACTCGAGTCGTGTCCAGAATAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033476.1-1187s1c1
Sequence:CCGGGCAGATGGAATCAGACTCTTTCTCGAGAAAGAGTCTGATTCCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks