EMAIL THIS PAGE TO A FRIEND

TFCP2L1

transcription factor CP2-like 1

Synonyms: CRTR1 LBP-9 LBP9
UniProtKB ID: Q9NZI6, Q4ZG43
Gene ID:
Mouse(81879) transcription factor CP2-like 1
Rat(304741) transcription factor CP2-like 1
naked mole-rat(101697022) transcription factor CP2-like 1
domestic guinea pig(100720387) transcription factor CP2-like 1
cow(518436) transcription factor CP2-like 1
sheep(101114420) transcription factor CP2-like 1
Zebrafish(431761) transcription factor CP2-like 1
dog(610193) transcription factor CP2-like 1
domestic cat(101101152) transcription factor CP2-like 1
chicken(424238) transcription factor CP2-like 1
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131231 MISSION® esiRNA esiRNA human TFCP2L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014553 Rosetta Predictions human pricing
NM_001107170 Rosetta Predictions rat pricing
NM_023755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076592 predicted 295
2 SASI_Hs01_00076594 predicted 482
3 SASI_Hs02_00345817 predicted 305
4 SASI_Hs02_00345818 predicted 342
5 SASI_Hs01_00076595 predicted 1115
6 SASI_Hs01_00076597 predicted 532
7 SASI_Hs01_00076598 predicted 666
8 SASI_Hs01_00076599 predicted 816
9 SASI_Hs01_00076600 predicted 1439
10 SASI_Hs01_00076601 predicted 1164
11 SASI_Hs01_00076593 predicted 1486
12 SASI_Hs01_00076596 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226195 predicted 1105
2 SASI_Rn02_00226196 predicted 1259
3 SASI_Rn02_00226197 predicted 1412
4 SASI_Rn02_00226198 predicted 284
5 SASI_Rn02_00226199 predicted 468
6 SASI_Rn02_00226200 predicted 1435
7 SASI_Rn02_00226201 predicted 666
8 SASI_Rn02_00226202 predicted 808
9 SASI_Rn02_00226203 predicted 418
10 SASI_Rn02_00226204 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327330 predicted 947
2 SASI_Mm02_00327331 predicted 367
3 SASI_Mm02_00327332 predicted 1424
4 SASI_Mm02_00327333 predicted 284
5 SASI_Mm02_00327334 predicted 1576
6 SASI_Mm02_00327335 predicted 1320
7 SASI_Mm02_00327336 predicted 1434
8 SASI_Mm02_00327337 predicted 817
9 SASI_Mm02_00327338 predicted 1439
10 SASI_Mm02_00327339 predicted 1340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014553
TFCP2L1 MISSION shRNA Bacterial Glycerol Stock
transcription factor CP2-like 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014553.1-3702s1c1
Sequence:CCGGCCTCATCAACACTTGCTATTACTCGAGTAATAGCAAGTGTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-658s1c1
Sequence:CCGGCGAGTCCAGATTGACACGTTTCTCGAGAAACGTGTCAATCTGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-1116s1c1
Sequence:CCGGCCGAGATGATTTGGTCCAGATCTCGAGATCTGGACCAAATCATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-1191s1c1
Sequence:CCGGGAGGCCAAAGATGACCATTTACTCGAGTAAATGGTCATCTTTGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-294s1c1
Sequence:CCGGCCTCAACCAAGGTCAGTCTTACTCGAGTAAGACTGACCTTGGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014553.2-1790s21c1
Sequence:CCGGGTCCAACCCTGACGTTCTAAACTCGAGTTTAGAACGTCAGGGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014553
TFCP2L1 MISSION shRNA shRNA Plasmid DNA
transcription factor CP2-like 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014553.1-3702s1c1
Sequence:CCGGCCTCATCAACACTTGCTATTACTCGAGTAATAGCAAGTGTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-658s1c1
Sequence:CCGGCGAGTCCAGATTGACACGTTTCTCGAGAAACGTGTCAATCTGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-1116s1c1
Sequence:CCGGCCGAGATGATTTGGTCCAGATCTCGAGATCTGGACCAAATCATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-1191s1c1
Sequence:CCGGGAGGCCAAAGATGACCATTTACTCGAGTAAATGGTCATCTTTGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-294s1c1
Sequence:CCGGCCTCAACCAAGGTCAGTCTTACTCGAGTAAGACTGACCTTGGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014553.2-1790s21c1
Sequence:CCGGGTCCAACCCTGACGTTCTAAACTCGAGTTTAGAACGTCAGGGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014553
TFCP2L1 MISSION shRNA Lentiviral Transduction Particles
transcription factor CP2-like 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014553.1-3702s1c1
Sequence:CCGGCCTCATCAACACTTGCTATTACTCGAGTAATAGCAAGTGTTGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-658s1c1
Sequence:CCGGCGAGTCCAGATTGACACGTTTCTCGAGAAACGTGTCAATCTGGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-1116s1c1
Sequence:CCGGCCGAGATGATTTGGTCCAGATCTCGAGATCTGGACCAAATCATCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-1191s1c1
Sequence:CCGGGAGGCCAAAGATGACCATTTACTCGAGTAAATGGTCATCTTTGGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014553.1-294s1c1
Sequence:CCGGCCTCAACCAAGGTCAGTCTTACTCGAGTAAGACTGACCTTGGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014553.2-1790s21c1
Sequence:CCGGGTCCAACCCTGACGTTCTAAACTCGAGTTTAGAACGTCAGGGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023755
VALIDATED
TFCP2L1 MISSION shRNA Bacterial Glycerol Stock
transcription factor CP2-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023755.1-284s1c1
Sequence:CCGGACCTTAACATACCTCAATCAACTCGAGTTGATTGAGGTATGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023755.1-810s1c1
Sequence:CCGGCGGCTCAAGAGAAGGAGAAATCTCGAGATTTCTCCTTCTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023755.1-598s1c1
Sequence:CCGGGCACTGTATCAGCACGGAATTCTCGAGAATTCCGTGCTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023755.1-5774s1c1
Sequence:CCGGCCCGCCTTTGAATCACTAATTCTCGAGAATTAGTGATTCAAAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023755.1-1420s1c1
Sequence:CCGGCGTGGTGGTAAGCAATGAGATCTCGAGATCTCATTGCTTACCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023755.2-2008s21c1
Sequence:CCGGTGATAAGACTGGAGCTATTTACTCGAGTAAATAGCTCCAGTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023755.2-809s21c1
Sequence:CCGGCGGCTCAAGAGAAGGAGAAATCTCGAGATTTCTCCTTCTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023755.2-603s21c1
Sequence:CCGGGCACTGTATCAGCACGGAATTCTCGAGAATTCCGTGCTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023755.2-1419s21c1
Sequence:CCGGCGTGGTGGTAAGCAATGAGATCTCGAGATCTCATTGCTTACCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023755
VALIDATED
TFCP2L1 MISSION shRNA shRNA Plasmid DNA
transcription factor CP2-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023755.1-284s1c1
Sequence:CCGGACCTTAACATACCTCAATCAACTCGAGTTGATTGAGGTATGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023755.1-810s1c1
Sequence:CCGGCGGCTCAAGAGAAGGAGAAATCTCGAGATTTCTCCTTCTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023755.1-598s1c1
Sequence:CCGGGCACTGTATCAGCACGGAATTCTCGAGAATTCCGTGCTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023755.1-5774s1c1
Sequence:CCGGCCCGCCTTTGAATCACTAATTCTCGAGAATTAGTGATTCAAAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023755.1-1420s1c1
Sequence:CCGGCGTGGTGGTAAGCAATGAGATCTCGAGATCTCATTGCTTACCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023755.2-2008s21c1
Sequence:CCGGTGATAAGACTGGAGCTATTTACTCGAGTAAATAGCTCCAGTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023755.2-809s21c1
Sequence:CCGGCGGCTCAAGAGAAGGAGAAATCTCGAGATTTCTCCTTCTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023755.2-603s21c1
Sequence:CCGGGCACTGTATCAGCACGGAATTCTCGAGAATTCCGTGCTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023755.2-1419s21c1
Sequence:CCGGCGTGGTGGTAAGCAATGAGATCTCGAGATCTCATTGCTTACCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023755
VALIDATED
TFCP2L1 MISSION shRNA Lentiviral Transduction Particles
transcription factor CP2-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023755.1-284s1c1
Sequence:CCGGACCTTAACATACCTCAATCAACTCGAGTTGATTGAGGTATGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023755.1-810s1c1
Sequence:CCGGCGGCTCAAGAGAAGGAGAAATCTCGAGATTTCTCCTTCTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023755.1-598s1c1
Sequence:CCGGGCACTGTATCAGCACGGAATTCTCGAGAATTCCGTGCTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023755.1-5774s1c1
Sequence:CCGGCCCGCCTTTGAATCACTAATTCTCGAGAATTAGTGATTCAAAGGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023755.1-1420s1c1
Sequence:CCGGCGTGGTGGTAAGCAATGAGATCTCGAGATCTCATTGCTTACCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023755.2-2008s21c1
Sequence:CCGGTGATAAGACTGGAGCTATTTACTCGAGTAAATAGCTCCAGTCTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023755.2-809s21c1
Sequence:CCGGCGGCTCAAGAGAAGGAGAAATCTCGAGATTTCTCCTTCTCTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023755.2-603s21c1
Sequence:CCGGGCACTGTATCAGCACGGAATTCTCGAGAATTCCGTGCTGATACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023755.2-1419s21c1
Sequence:CCGGCGTGGTGGTAAGCAATGAGATCTCGAGATCTCATTGCTTACCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks