EMAIL THIS PAGE TO A FRIEND

TFDP1

transcription factor Dp-1

Synonyms: DP1 DRTF1 Dp-1
UniProtKB ID: Q14186, Q5JSB4, Q8IZL5
Gene ID:
Human(7027) Summary: This gene encodes a member of a family of transcription factors that heterodimerize with E2F proteins to enhance their DNA-binding activity and promote transcription from E2F target genes. The encoded protein functions as part of this complex to control the transcriptional activity of numerous genes involved in cell cycle progression from G1 to S phase. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1, 15, and X.[provided by RefSeq, Jan 2009]
Mouse(21781) transcription factor Dp 1
chicken(418739) transcription factor Dp-1
domestic cat(101091838) transcription factor Dp-1
dog(607720) transcription factor Dp-1
cow(534579) transcription factor Dp-1
sheep(101117516) transcription factor Dp-1
domestic guinea pig(100725779) transcription factor Dp-1
naked mole-rat(101720935) transcription factor Dp-1
Domestic Rabbit(100354495) transcription factor Dp-1
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D6562 Anti-DP-1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4502951 Anti-DP-1, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1406525 Anti-TFDP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV100820 Anti-TFDP1 antibody produced in rabbit affinity isolated antibody human, mouse, bovine
immunohistochemistry, western blot pricing
SAB2102411 Anti-TFDP1 antibody produced in rabbit affinity isolated antibody zebrafish, mouse, bovine, rat, human
western blot pricing
SAB2103915 Anti-TFDP1 antibody produced in rabbit affinity isolated antibody bovine, rat, zebrafish, human, mouse
western blot pricing
SAB2106451 Anti-TFDP1 antibody produced in rabbit affinity isolated antibody rabbit, mouse, horse, guinea pig, human
ELISA, western blot pricing
HPA044754 Anti-TFDP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA068909 Anti-TFDP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1402942 Monoclonal Anti-TFDP1 antibody produced in mouse clone 3E4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009361 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009361 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009361 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007111 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007111 Rosetta Predictions human pricing
NM_009361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022124 predicted 1041
2 SASI_Hs01_00022126 predicted 1919
3 SASI_Hs02_00342964 predicted 1003
4 SASI_Hs01_00022127 predicted 1761
5 SASI_Hs02_00342965 predicted 642
6 SASI_Hs01_00022128 predicted 1910
7 SASI_Hs02_00342966 predicted 418
8 SASI_Hs02_00342967 predicted 1827
9 SASI_Hs01_00022125 predicted 1045
10 SASI_Hs02_00342968 predicted 661
11 SASI_Hs01_00022129 predicted 1920
12 SASI_Hs01_00022130 predicted 1044
13 SASI_Hs01_00022131 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084037 predicted 1103
2 SASI_Mm01_00084038 predicted 922
3 SASI_Mm01_00084040 predicted 888
4 SASI_Mm01_00084041 predicted 555
5 SASI_Mm01_00084042 predicted 402
6 SASI_Mm01_00084043 predicted 448
7 SASI_Mm01_00084044 predicted 239
8 SASI_Mm01_00084045 predicted 1251
9 SASI_Mm01_00084046 predicted 1275
10 SASI_Mm02_00315961 predicted 320
11 SASI_Mm01_00084039 predicted 1103
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009361
VALIDATED
TFDP1 MISSION shRNA Bacterial Glycerol Stock
transcription factor Dp-1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-1072s21c1
Sequence:CCGGGGATCCATTGGTGGAGTATTCCTCGAGGAATACTCCACCAATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-496s21c1
Sequence:CCGGGCTGCCGACAACCACATTCTACTCGAGTAGAATGTGGTTGTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-735s21c1
Sequence:CCGGCCTGCAGCAAATTGCCTTCAACTCGAGTTGAAGGCAATTTGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-507s21c1
Sequence:CCGGCCACATTCTACCAAACGAATCCTCGAGGATTCGTTTGGTAGAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009361.2-1500s21c1
Sequence:CCGGGCAGAGCCTCTATCTACCTTTCTCGAGAAAGGTAGATAGAGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-605s21c1
Sequence:CCGGAGGAGAAGAAGGAGATCAAATCTCGAGATTTGATCTCCTTCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-1500s1c1
Sequence:CCGGGCAGAGCCTCTATCTACCTTTCTCGAGAAAGGTAGATAGAGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-555s1c1
Sequence:CCGGGCGTGTCTACGATGCCTTAAACTCGAGTTTAAGGCATCGTAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-111s1c1
Sequence:CCGGCCAGAATCTTAGTCCTGGGAACTCGAGTTCCCAGGACTAAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-735s1c1
Sequence:CCGGCCTGCAGCAAATTGCCTTCAACTCGAGTTGAAGGCAATTTGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009361.1-564s1c1
Sequence:CCGGCGATGCCTTAAATGTGCTAATCTCGAGATTAGCACATTTAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009361
VALIDATED
TFDP1 MISSION shRNA shRNA Plasmid DNA
transcription factor Dp-1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-1072s21c1
Sequence:CCGGGGATCCATTGGTGGAGTATTCCTCGAGGAATACTCCACCAATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-496s21c1
Sequence:CCGGGCTGCCGACAACCACATTCTACTCGAGTAGAATGTGGTTGTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-735s21c1
Sequence:CCGGCCTGCAGCAAATTGCCTTCAACTCGAGTTGAAGGCAATTTGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-507s21c1
Sequence:CCGGCCACATTCTACCAAACGAATCCTCGAGGATTCGTTTGGTAGAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009361.2-1500s21c1
Sequence:CCGGGCAGAGCCTCTATCTACCTTTCTCGAGAAAGGTAGATAGAGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-605s21c1
Sequence:CCGGAGGAGAAGAAGGAGATCAAATCTCGAGATTTGATCTCCTTCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-1500s1c1
Sequence:CCGGGCAGAGCCTCTATCTACCTTTCTCGAGAAAGGTAGATAGAGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-555s1c1
Sequence:CCGGGCGTGTCTACGATGCCTTAAACTCGAGTTTAAGGCATCGTAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-111s1c1
Sequence:CCGGCCAGAATCTTAGTCCTGGGAACTCGAGTTCCCAGGACTAAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-735s1c1
Sequence:CCGGCCTGCAGCAAATTGCCTTCAACTCGAGTTGAAGGCAATTTGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009361.1-564s1c1
Sequence:CCGGCGATGCCTTAAATGTGCTAATCTCGAGATTAGCACATTTAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009361
VALIDATED
TFDP1 MISSION shRNA Lentiviral Transduction Particles
transcription factor Dp-1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-1072s21c1
Sequence:CCGGGGATCCATTGGTGGAGTATTCCTCGAGGAATACTCCACCAATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-496s21c1
Sequence:CCGGGCTGCCGACAACCACATTCTACTCGAGTAGAATGTGGTTGTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-735s21c1
Sequence:CCGGCCTGCAGCAAATTGCCTTCAACTCGAGTTGAAGGCAATTTGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-507s21c1
Sequence:CCGGCCACATTCTACCAAACGAATCCTCGAGGATTCGTTTGGTAGAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009361.2-1500s21c1
Sequence:CCGGGCAGAGCCTCTATCTACCTTTCTCGAGAAAGGTAGATAGAGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009361.2-605s21c1
Sequence:CCGGAGGAGAAGAAGGAGATCAAATCTCGAGATTTGATCTCCTTCTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-1500s1c1
Sequence:CCGGGCAGAGCCTCTATCTACCTTTCTCGAGAAAGGTAGATAGAGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-555s1c1
Sequence:CCGGGCGTGTCTACGATGCCTTAAACTCGAGTTTAAGGCATCGTAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-111s1c1
Sequence:CCGGCCAGAATCTTAGTCCTGGGAACTCGAGTTCCCAGGACTAAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009361.1-735s1c1
Sequence:CCGGCCTGCAGCAAATTGCCTTCAACTCGAGTTGAAGGCAATTTGCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009361.1-564s1c1
Sequence:CCGGCGATGCCTTAAATGTGCTAATCTCGAGATTAGCACATTTAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007111
VALIDATED
TFDP1 MISSION shRNA Bacterial Glycerol Stock
transcription factor Dp-1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007111.4-557s21c1
Sequence:CCGGCCTACGGCATTTCTCCATGAACTCGAGTTCATGGAGAAATGCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1265s21c1
Sequence:CCGGTTCCACGTCTAACGGCACAAGCTCGAGCTTGTGCCGTTAGACGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1410s21c1
Sequence:CCGGGACGATGACTTCAACGAGAATCTCGAGATTCTCGTTGAAGTCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1027s21c1
Sequence:CCGGTCGACTGCAGCATCTCCAATGCTCGAGCATTGGAGATGCTGCAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1828s21c1
Sequence:CCGGCCGCTTATTTGCCGTGAGTTTCTCGAGAAACTCACGGCAAATAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007111.3-1828s1c1
Sequence:CCGGCCGCTTATTTGCCGTGAGTTTCTCGAGAAACTCACGGCAAATAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007111.3-557s1c1
Sequence:CCGGCCTACGGCATTTCTCCATGAACTCGAGTTCATGGAGAAATGCCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_007111.3-258s1c1
Sequence:CCGGGTCTTCATAGACCAGAACCTTCTCGAGAAGGTTCTGGTCTATGAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007111.3-1410s1c1
Sequence:CCGGGACGATGACTTCAACGAGAATCTCGAGATTCTCGTTGAAGTCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_007111.3-659s1c1
Sequence:CCGGCGACAACCACATCTTACCAAACTCGAGTTTGGTAAGATGTGGTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007111
VALIDATED
TFDP1 MISSION shRNA shRNA Plasmid DNA
transcription factor Dp-1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007111.4-557s21c1
Sequence:CCGGCCTACGGCATTTCTCCATGAACTCGAGTTCATGGAGAAATGCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1265s21c1
Sequence:CCGGTTCCACGTCTAACGGCACAAGCTCGAGCTTGTGCCGTTAGACGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1410s21c1
Sequence:CCGGGACGATGACTTCAACGAGAATCTCGAGATTCTCGTTGAAGTCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1027s21c1
Sequence:CCGGTCGACTGCAGCATCTCCAATGCTCGAGCATTGGAGATGCTGCAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1828s21c1
Sequence:CCGGCCGCTTATTTGCCGTGAGTTTCTCGAGAAACTCACGGCAAATAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007111.3-1828s1c1
Sequence:CCGGCCGCTTATTTGCCGTGAGTTTCTCGAGAAACTCACGGCAAATAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007111.3-557s1c1
Sequence:CCGGCCTACGGCATTTCTCCATGAACTCGAGTTCATGGAGAAATGCCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_007111.3-258s1c1
Sequence:CCGGGTCTTCATAGACCAGAACCTTCTCGAGAAGGTTCTGGTCTATGAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007111.3-1410s1c1
Sequence:CCGGGACGATGACTTCAACGAGAATCTCGAGATTCTCGTTGAAGTCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_007111.3-659s1c1
Sequence:CCGGCGACAACCACATCTTACCAAACTCGAGTTTGGTAAGATGTGGTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007111
VALIDATED
TFDP1 MISSION shRNA Lentiviral Transduction Particles
transcription factor Dp-1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007111.4-557s21c1
Sequence:CCGGCCTACGGCATTTCTCCATGAACTCGAGTTCATGGAGAAATGCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1265s21c1
Sequence:CCGGTTCCACGTCTAACGGCACAAGCTCGAGCTTGTGCCGTTAGACGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1410s21c1
Sequence:CCGGGACGATGACTTCAACGAGAATCTCGAGATTCTCGTTGAAGTCATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1027s21c1
Sequence:CCGGTCGACTGCAGCATCTCCAATGCTCGAGCATTGGAGATGCTGCAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285159    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_007111.4-1828s21c1
Sequence:CCGGCCGCTTATTTGCCGTGAGTTTCTCGAGAAACTCACGGCAAATAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007111.3-1828s1c1
Sequence:CCGGCCGCTTATTTGCCGTGAGTTTCTCGAGAAACTCACGGCAAATAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_007111.3-557s1c1
Sequence:CCGGCCTACGGCATTTCTCCATGAACTCGAGTTCATGGAGAAATGCCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_007111.3-258s1c1
Sequence:CCGGGTCTTCATAGACCAGAACCTTCTCGAGAAGGTTCTGGTCTATGAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007111.3-1410s1c1
Sequence:CCGGGACGATGACTTCAACGAGAATCTCGAGATTCTCGTTGAAGTCATCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_007111.3-659s1c1
Sequence:CCGGCGACAACCACATCTTACCAAACTCGAGTTTGGTAAGATGTGGTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks