EMAIL THIS PAGE TO A FRIEND

TFDP2

transcription factor Dp-2 (E2F dimerization partner 2)

Synonyms: DP2
Gene ID:
Human(7029) Summary: The gene is a member of the transcription factor DP family. The encoded protein forms heterodimers with the E2F transcription factors resulting in transcriptional activation of cell cycle regulated genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(211586) transcription factor Dp 2
Rat(300947) transcription factor Dp-2 (E2F dimerization partner 2)
Zebrafish(338204) transcription factor Dp-2
chicken(424780) transcription factor Dp-2 (E2F dimerization partner 2)
dog(477099) transcription factor Dp-2 (E2F dimerization partner 2)
domestic cat(101088513) transcription factor Dp-2 (E2F dimerization partner 2)
Horse(100051405) transcription factor Dp-2 (E2F dimerization partner 2)
cow(506114) transcription factor Dp-2 (E2F dimerization partner 2)
sheep(101105870) transcription factor Dp-2 (E2F dimerization partner 2)
naked mole-rat(101698510) transcription factor Dp-2 (E2F dimerization partner 2)
domestic guinea pig(100731320) transcription factor Dp-2 (E2F dimerization partner 2)
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006286 Rosetta Predictions human pricing
NM_001106847 Rosetta Predictions rat pricing
NM_178667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341272 predicted 775
2 SASI_Hs01_00140708 predicted 939
3 SASI_Hs01_00140709 predicted 849
4 SASI_Hs01_00140710 predicted 818
5 SASI_Hs02_00341273 predicted 811
6 SASI_Hs01_00140712 predicted 726
7 SASI_Hs02_00341274 predicted 777
8 SASI_Hs02_00341275 predicted 900
9 SASI_Hs01_00140714 predicted 766
10 SASI_Hs01_00140715 predicted 862
11 SASI_Hs01_00140706 predicted 1305
12 SASI_Hs01_00140707 predicted 1134
13 SASI_Hs01_00140711 predicted 1307
14 SASI_Hs01_00140713 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222986 predicted 1583
2 SASI_Rn02_00222987 predicted 1054
3 SASI_Rn02_00222988 predicted 916
4 SASI_Rn02_00222989 predicted 816
5 SASI_Rn02_00222990 predicted 907
6 SASI_Rn02_00222991 predicted 1513
7 SASI_Rn02_00222992 predicted 1062
8 SASI_Rn02_00222993 predicted 1039
9 SASI_Rn02_00222994 predicted 1114
10 SASI_Rn02_00222995 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198754 predicted 1340
2 SASI_Mm01_00198755 predicted 1244
3 SASI_Mm01_00198756 predicted 593
4 SASI_Mm01_00198757 predicted 1388
5 SASI_Mm02_00349124 predicted 1640
6 SASI_Mm01_00198758 predicted 1189
7 SASI_Mm02_00349125 predicted 687
8 SASI_Mm01_00198759 predicted 1298
9 SASI_Mm01_00198760 predicted 1433
10 SASI_Mm01_00198761 predicted 1175
11 SASI_Mm01_00198753 predicted 618
12 SASI_Mm01_00198762 predicted 1673
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006286
TFDP2 MISSION shRNA Bacterial Glycerol Stock
transcription factor Dp-2 (E2F dimerization partner 2)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006286.1-1454s1c1
Sequence:CCGGGCTGAGATGATTGAGATGAAACTCGAGTTTCATCTCAATCATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006286.1-954s1c1
Sequence:CCGGGAGGATCTGAAACTTGCGAAACTCGAGTTTCGCAAGTTTCAGATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006286.1-504s1c1
Sequence:CCGGCGAAGAGTTTATGATGCTTTACTCGAGTAAAGCATCATAAACTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006286.1-1239s1c1
Sequence:CCGGCCCTGTTCGTTCAATGATGAACTCGAGTTCATCATTGAACGAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-839s21c1
Sequence:CCGGTGATGACATAGAAGTACTAAACTCGAGTTTAGTACTTCTATGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-1007s21c1
Sequence:CCGGGAACTCTACCCAATCAGTTTCCTCGAGGAAACTGATTGGGTAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-395s21c1
Sequence:CCGGCACCAATTCAAATAACCATTTCTCGAGAAATGGTTATTTGAATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-587s21c1
Sequence:CCGGGAGGCGGATAGAACGGATAAACTCGAGTTTATCCGTTCTATCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-483s21c1
Sequence:CCGGCTAATGGCAATGAACATAATTCTCGAGAATTATGTTCATTGCCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006286
TFDP2 MISSION shRNA shRNA Plasmid DNA
transcription factor Dp-2 (E2F dimerization partner 2)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006286.1-1454s1c1
Sequence:CCGGGCTGAGATGATTGAGATGAAACTCGAGTTTCATCTCAATCATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006286.1-954s1c1
Sequence:CCGGGAGGATCTGAAACTTGCGAAACTCGAGTTTCGCAAGTTTCAGATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006286.1-504s1c1
Sequence:CCGGCGAAGAGTTTATGATGCTTTACTCGAGTAAAGCATCATAAACTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006286.1-1239s1c1
Sequence:CCGGCCCTGTTCGTTCAATGATGAACTCGAGTTCATCATTGAACGAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-839s21c1
Sequence:CCGGTGATGACATAGAAGTACTAAACTCGAGTTTAGTACTTCTATGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-1007s21c1
Sequence:CCGGGAACTCTACCCAATCAGTTTCCTCGAGGAAACTGATTGGGTAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-395s21c1
Sequence:CCGGCACCAATTCAAATAACCATTTCTCGAGAAATGGTTATTTGAATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-587s21c1
Sequence:CCGGGAGGCGGATAGAACGGATAAACTCGAGTTTATCCGTTCTATCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-483s21c1
Sequence:CCGGCTAATGGCAATGAACATAATTCTCGAGAATTATGTTCATTGCCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006286
TFDP2 MISSION shRNA Lentiviral Transduction Particles
transcription factor Dp-2 (E2F dimerization partner 2)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006286.1-1454s1c1
Sequence:CCGGGCTGAGATGATTGAGATGAAACTCGAGTTTCATCTCAATCATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006286.1-954s1c1
Sequence:CCGGGAGGATCTGAAACTTGCGAAACTCGAGTTTCGCAAGTTTCAGATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006286.1-504s1c1
Sequence:CCGGCGAAGAGTTTATGATGCTTTACTCGAGTAAAGCATCATAAACTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006286.1-1239s1c1
Sequence:CCGGCCCTGTTCGTTCAATGATGAACTCGAGTTCATCATTGAACGAACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-839s21c1
Sequence:CCGGTGATGACATAGAAGTACTAAACTCGAGTTTAGTACTTCTATGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-1007s21c1
Sequence:CCGGGAACTCTACCCAATCAGTTTCCTCGAGGAAACTGATTGGGTAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-395s21c1
Sequence:CCGGCACCAATTCAAATAACCATTTCTCGAGAAATGGTTATTTGAATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-587s21c1
Sequence:CCGGGAGGCGGATAGAACGGATAAACTCGAGTTTATCCGTTCTATCCGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006286.3-483s21c1
Sequence:CCGGCTAATGGCAATGAACATAATTCTCGAGAATTATGTTCATTGCCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178667
VALIDATED
TFDP2 MISSION shRNA Bacterial Glycerol Stock
transcription factor Dp-2 (E2F dimerization partner 2)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-1790s1c1
Sequence:CCGGGCTGAGATGATTGAACTGAAACTCGAGTTTCAGTTCAATCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-1575s1c1
Sequence:CCGGCCCTGTTCATTCAACGATGAACTCGAGTTCATCGTTGAATGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178667.2-924s1c1
Sequence:CCGGCCTACCAATTCTGCTCAGGAACTCGAGTTCCTGAGCAGAATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-1354s1c1
Sequence:CCGGCCACAGGACCTTCTTGGTTAACTCGAGTTAACCAAGAAGGTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-830s1c1
Sequence:CCGGGAACATTAGACGAAGAGTTTACTCGAGTAAACTCTTCGTCTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178667
VALIDATED
TFDP2 MISSION shRNA shRNA Plasmid DNA
transcription factor Dp-2 (E2F dimerization partner 2)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-1790s1c1
Sequence:CCGGGCTGAGATGATTGAACTGAAACTCGAGTTTCAGTTCAATCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-1575s1c1
Sequence:CCGGCCCTGTTCATTCAACGATGAACTCGAGTTCATCGTTGAATGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178667.2-924s1c1
Sequence:CCGGCCTACCAATTCTGCTCAGGAACTCGAGTTCCTGAGCAGAATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-1354s1c1
Sequence:CCGGCCACAGGACCTTCTTGGTTAACTCGAGTTAACCAAGAAGGTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-830s1c1
Sequence:CCGGGAACATTAGACGAAGAGTTTACTCGAGTAAACTCTTCGTCTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178667
VALIDATED
TFDP2 MISSION shRNA Lentiviral Transduction Particles
transcription factor Dp-2 (E2F dimerization partner 2)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-1790s1c1
Sequence:CCGGGCTGAGATGATTGAACTGAAACTCGAGTTTCAGTTCAATCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-1575s1c1
Sequence:CCGGCCCTGTTCATTCAACGATGAACTCGAGTTCATCGTTGAATGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178667.2-924s1c1
Sequence:CCGGCCTACCAATTCTGCTCAGGAACTCGAGTTCCTGAGCAGAATTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-1354s1c1
Sequence:CCGGCCACAGGACCTTCTTGGTTAACTCGAGTTAACCAAGAAGGTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178667.2-830s1c1
Sequence:CCGGGAACATTAGACGAAGAGTTTACTCGAGTAAACTCTTCGTCTAATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks