EMAIL THIS PAGE TO A FRIEND

TFDP3

transcription factor Dp family, member 3

Synonyms: CT30 DP4 HCA661
Species: Human TFDP3(51270)
UniProtKB ID: Q5H9I0, Q6DK49, Q9NZ54
Gene ID:
Human(51270) Summary: This gene encodes a member of the DP family of transcription factors. These factors heterodimerize with E2F proteins to enhance their DNA-binding activity and promote transcription from E2F target genes. This protein functions as a negative regulator and inhibits the DNA binding and transcriptional activities of E2F factors.[provided by RefSeq, May 2010]
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016521 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148611 MISSION® esiRNA esiRNA human TFDP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016521 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220166 predicted 342
2 SASI_Hs01_00220167 predicted 1036
3 SASI_Hs01_00220168 predicted 1119
4 SASI_Hs01_00220169 predicted 678
5 SASI_Hs02_00349616 predicted 901
6 SASI_Hs01_00220170 predicted 673
7 SASI_Hs02_00349617 predicted 869
8 SASI_Hs01_00220171 predicted 917
9 SASI_Hs01_00220172 predicted 957
10 SASI_Hs02_00349618 predicted 966
11 SASI_Hs01_00220173 predicted 911
12 SASI_Hs01_00220174 predicted 916
13 SASI_Hs01_00220175 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016521
TFDP3 MISSION shRNA Bacterial Glycerol Stock
transcription factor Dp family, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016521.2-895s21c1
Sequence:CCGGGCAGCATCTCCGACGACAAATCTCGAGATTTGTCGTCGGAGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016521.2-1303s21c1
Sequence:CCGGACTGACGTCCTCTCGCCTTAACTCGAGTTAAGGCGAGAGGACGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016521.2-122s21c1
Sequence:CCGGCGAAGAACTCAAGGTCTTAATCTCGAGATTAAGACCTTGAGTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-869s1c1
Sequence:CCGGCAGTAGCAAGAAGACCGTCATCTCGAGATGACGGTCTTCTTGCTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-299s1c1
Sequence:CCGGCCCTGTGGTAGGAAGCCCAAACTCGAGTTTGGGCTTCCTACCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-926s1c1
Sequence:CCGGGTTTAAGTTTAACAGCTCCTTCTCGAGAAGGAGCTGTTAAACTTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-1163s1c1
Sequence:CCGGGACCAACATTGCGATTGGGATCTCGAGATCCCAATCGCAATGTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-1272s1c1
Sequence:CCGGGATGACGACCTCAGTGAGAATCTCGAGATTCTCACTGAGGTCGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016521
TFDP3 MISSION shRNA shRNA Plasmid DNA
transcription factor Dp family, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016521.2-895s21c1
Sequence:CCGGGCAGCATCTCCGACGACAAATCTCGAGATTTGTCGTCGGAGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016521.2-1303s21c1
Sequence:CCGGACTGACGTCCTCTCGCCTTAACTCGAGTTAAGGCGAGAGGACGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016521.2-122s21c1
Sequence:CCGGCGAAGAACTCAAGGTCTTAATCTCGAGATTAAGACCTTGAGTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-869s1c1
Sequence:CCGGCAGTAGCAAGAAGACCGTCATCTCGAGATGACGGTCTTCTTGCTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-299s1c1
Sequence:CCGGCCCTGTGGTAGGAAGCCCAAACTCGAGTTTGGGCTTCCTACCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-926s1c1
Sequence:CCGGGTTTAAGTTTAACAGCTCCTTCTCGAGAAGGAGCTGTTAAACTTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-1163s1c1
Sequence:CCGGGACCAACATTGCGATTGGGATCTCGAGATCCCAATCGCAATGTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-1272s1c1
Sequence:CCGGGATGACGACCTCAGTGAGAATCTCGAGATTCTCACTGAGGTCGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016521
TFDP3 MISSION shRNA Lentiviral Transduction Particles
transcription factor Dp family, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016521.2-895s21c1
Sequence:CCGGGCAGCATCTCCGACGACAAATCTCGAGATTTGTCGTCGGAGATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016521.2-1303s21c1
Sequence:CCGGACTGACGTCCTCTCGCCTTAACTCGAGTTAAGGCGAGAGGACGTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016521.2-122s21c1
Sequence:CCGGCGAAGAACTCAAGGTCTTAATCTCGAGATTAAGACCTTGAGTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-869s1c1
Sequence:CCGGCAGTAGCAAGAAGACCGTCATCTCGAGATGACGGTCTTCTTGCTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-299s1c1
Sequence:CCGGCCCTGTGGTAGGAAGCCCAAACTCGAGTTTGGGCTTCCTACCACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-926s1c1
Sequence:CCGGGTTTAAGTTTAACAGCTCCTTCTCGAGAAGGAGCTGTTAAACTTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-1163s1c1
Sequence:CCGGGACCAACATTGCGATTGGGATCTCGAGATCCCAATCGCAATGTTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016521.2-1272s1c1
Sequence:CCGGGATGACGACCTCAGTGAGAATCTCGAGATTCTCACTGAGGTCGTCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks