EMAIL THIS PAGE TO A FRIEND

TFE3

transcription factor binding to IGHM enhancer 3

Synonyms: RCCP2 RCCX1 TFEA bHLHe33
UniProtKB ID: P19532, A8MZL6, Q92757, Q92758, Q99964
Gene ID:
Human(7030) Summary: The microphthalmia transcription factor/transcription factor E (MITF-TFE) family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors includes four family members: MITF, TFE3, TFEB and TFEC. The TEF3 protein encoded by this gene activates transcription through binding to the muE3 motif of the immunoglobulin heavy-chain enhancer. The TFEC protein forms heterodimers with the TEF3 protein and inhibits TFE3-dependent transcription activation. The TEF3 protein interacts with transcription regulators such as E2F3, SMAD3, and LEF-1, and is involved in TGF-beta-induced transcription, playing important roles in cell growth, proliferation, and osteoclast and macrophage differentiation. The TFE3 protein also activates hepatic IRS-2 gene, and induces hexokinase II (HK2) and insulin-induced gene 1 (INSIG1); it participates in insulin signaling and could be a therapeutic target for diabetes. This gene is also involved in chromosomal translocations, resulting in different fusion gene products in papillary renal cell carcinomas and alveolar soft part sarcomas, such as PRCC-TFE3, RCC17-TFE3, PSF-TFE3, NonO (p54nrb)-TFE3 and ASPL-TFE3.[provided by RefSeq, Dec 2009]
Mouse(209446) transcription factor E3
Rat(317376) transcription factor binding to IGHM enhancer 3
domestic cat(101099025) transcription factor binding to IGHM enhancer 3
dog(491872) transcription factor binding to IGHM enhancer 3
domestic guinea pig(100733366) transcription factor binding to IGHM enhancer 3
naked mole-rat(101715111) transcription factor binding to IGHM enhancer 3
cow(520800) transcription factor binding to IGHM enhancer 3
sheep(101106403) transcription factor binding to IGHM enhancer 3
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501711 Anti-TFE3 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, canine, bovine, human
ELISA, western blot pricing
HPA023881 Anti-TFE3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102412 Anti-TFE3 antibody produced in rabbit affinity isolated antibody zebrafish, canine, rabbit, rat, human, guinea pig, mouse, bovine, horse, sheep
western blot pricing
SAB2104073 Anti-TFE3 antibody produced in rabbit affinity isolated antibody horse, rat, bovine, human, guinea pig, rabbit, canine, mouse
western blot pricing
SAB4300673 Anti-TFE3 antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4502952 Anti-TFE3 antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB2107961 Anti-TFEB antibody produced in rabbit IgG fraction of antiserum bovine, mouse, pig, rabbit, rat, horse, human, guinea pig, zebrafish, sheep, yeast, canine, goat
western blot pricing
GW20056A Anti-Transcription Factor E3 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006521 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006521 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006521 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157921 MISSION® esiRNA esiRNA human TFE3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006521 Rosetta Predictions human pricing
XM_228760 Rosetta Predictions rat pricing
XR_008119 Rosetta Predictions rat pricing
NM_001105196 Rosetta Predictions mouse pricing
NM_172472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111844 predicted 501
2 SASI_Hs02_00341761 predicted 413
3 SASI_Hs01_00111845 predicted 682
4 SASI_Hs01_00111846 predicted 1978
5 SASI_Hs01_00111848 predicted 2338
6 SASI_Hs01_00111849 predicted 1129
7 SASI_Hs01_00111850 predicted 1013
8 SASI_Hs01_00111851 predicted 459
9 SASI_Hs01_00111852 predicted 1985
10 SASI_Hs01_00111853 predicted 548
11 SASI_Hs01_00111847 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228760 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385457 predicted 988
2 SASI_Rn02_00385458 predicted 1020
3 SASI_Rn02_00385459 predicted 1400
4 SASI_Rn02_00385460 predicted 838
5 SASI_Rn02_00385461 predicted 1120
6 SASI_Rn02_00385462 predicted 550
7 SASI_Rn02_00385463 predicted 848
8 SASI_Rn02_00385464 predicted 1223
9 SASI_Rn02_00385465 predicted 786
10 SASI_Rn02_00385466 predicted 728
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140686 predicted 2943
2 SASI_Rn01_00140687 predicted 526
3 SASI_Rn01_00140688 predicted 1449
4 SASI_Rn01_00140689 predicted 2919
5 SASI_Rn01_00140690 predicted 1830
6 SASI_Rn01_00140691 predicted 1270
7 SASI_Rn02_00416259 predicted 2706
8 SASI_Rn01_00140692 predicted 2892
9 SASI_Rn02_00416260 predicted 2348
10 SASI_Rn01_00140693 predicted 3092
11 SASI_Rn01_00140694 predicted 1561
12 SASI_Rn01_00140695 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303945 predicted 542
2 SASI_Mm02_00303946 predicted 1952
3 SASI_Mm02_00303947 predicted 1345
4 SASI_Mm02_00303948 predicted 1621
5 SASI_Mm02_00303949 predicted 618
6 SASI_Mm02_00303950 predicted 1416
7 SASI_Mm02_00303951 predicted 1715
8 SASI_Mm02_00303952 predicted 1362
9 SASI_Mm02_00303953 predicted 1653
10 SASI_Mm02_00303954 predicted 1880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344020 predicted 547
2 SASI_Mm01_00085148 predicted 2055
3 SASI_Mm01_00085149 predicted 1453
4 SASI_Mm01_00085150 predicted 1727
5 SASI_Mm02_00344021 predicted 618
6 SASI_Mm01_00085152 predicted 1519
7 SASI_Mm02_00344022 predicted 1825
8 SASI_Mm02_00344023 predicted 1464
9 SASI_Mm01_00085153 predicted 1764
10 SASI_Mm02_00344024 predicted 1992
11 SASI_Mm01_00085144 predicted 880
12 SASI_Mm01_00085145 predicted 1843
13 SASI_Mm01_00085146 predicted 1010
14 SASI_Mm01_00085147 predicted 836
15 SASI_Mm01_00085151 predicted 630
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006521
VALIDATED
TFE3 MISSION shRNA Bacterial Glycerol Stock
transcription factor binding to IGHM enhancer 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_006521.3-3117s1c1
Sequence:CCGGCCCTCATTTGTTTATCTGATTCTCGAGAATCAGATAAACAAATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006521.3-386s1c1
Sequence:CCGGGTTGCTGACATAGAATTAGAACTCGAGTTCTAATTCTATGTCAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006521.3-1508s1c1
Sequence:CCGGCAGCTCCGAATTCAGGAACTACTCGAGTAGTTCCTGAATTCGGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006521.3-1063s1c1
Sequence:CCGGCAATGATGAAATGCTCAGCTACTCGAGTAGCTGAGCATTTCATCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006521.3-507s1c1
Sequence:CCGGCTACACTCTCTGCATCGTCTTCTCGAGAAGACGATGCAGAGAGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-3083s21c1
Sequence:CCGGAGCTTGGAGGAGGGTTGTAAACTCGAGTTTACAACCCTCCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-1047s21c1
Sequence:CCGGGCCTGGAGTCCAGTTACAATGCTCGAGCATTGTAACTGGACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-1014s21c1
Sequence:CCGGAGGAGATTGATGATGTCATTGCTCGAGCAATGACATCATCAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006521.3-460s21c1
Sequence:CCGGTCGCTCAAGCCTCCCAATATCCTCGAGGATATTGGGAGGCTTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-383s21c1
Sequence:CCGGATTGTTGCTGACATAGAATTACTCGAGTAATTCTATGTCAGCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006521
VALIDATED
TFE3 MISSION shRNA shRNA Plasmid DNA
transcription factor binding to IGHM enhancer 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_006521.3-3117s1c1
Sequence:CCGGCCCTCATTTGTTTATCTGATTCTCGAGAATCAGATAAACAAATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006521.3-386s1c1
Sequence:CCGGGTTGCTGACATAGAATTAGAACTCGAGTTCTAATTCTATGTCAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006521.3-1508s1c1
Sequence:CCGGCAGCTCCGAATTCAGGAACTACTCGAGTAGTTCCTGAATTCGGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006521.3-1063s1c1
Sequence:CCGGCAATGATGAAATGCTCAGCTACTCGAGTAGCTGAGCATTTCATCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006521.3-507s1c1
Sequence:CCGGCTACACTCTCTGCATCGTCTTCTCGAGAAGACGATGCAGAGAGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-3083s21c1
Sequence:CCGGAGCTTGGAGGAGGGTTGTAAACTCGAGTTTACAACCCTCCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-1047s21c1
Sequence:CCGGGCCTGGAGTCCAGTTACAATGCTCGAGCATTGTAACTGGACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-1014s21c1
Sequence:CCGGAGGAGATTGATGATGTCATTGCTCGAGCAATGACATCATCAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006521.3-460s21c1
Sequence:CCGGTCGCTCAAGCCTCCCAATATCCTCGAGGATATTGGGAGGCTTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-383s21c1
Sequence:CCGGATTGTTGCTGACATAGAATTACTCGAGTAATTCTATGTCAGCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006521
VALIDATED
TFE3 MISSION shRNA Lentiviral Transduction Particles
transcription factor binding to IGHM enhancer 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_006521.3-3117s1c1
Sequence:CCGGCCCTCATTTGTTTATCTGATTCTCGAGAATCAGATAAACAAATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_006521.3-386s1c1
Sequence:CCGGGTTGCTGACATAGAATTAGAACTCGAGTTCTAATTCTATGTCAGCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_006521.3-1508s1c1
Sequence:CCGGCAGCTCCGAATTCAGGAACTACTCGAGTAGTTCCTGAATTCGGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006521.3-1063s1c1
Sequence:CCGGCAATGATGAAATGCTCAGCTACTCGAGTAGCTGAGCATTTCATCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006521.3-507s1c1
Sequence:CCGGCTACACTCTCTGCATCGTCTTCTCGAGAAGACGATGCAGAGAGTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-3083s21c1
Sequence:CCGGAGCTTGGAGGAGGGTTGTAAACTCGAGTTTACAACCCTCCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-1047s21c1
Sequence:CCGGGCCTGGAGTCCAGTTACAATGCTCGAGCATTGTAACTGGACTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-1014s21c1
Sequence:CCGGAGGAGATTGATGATGTCATTGCTCGAGCAATGACATCATCAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006521.3-460s21c1
Sequence:CCGGTCGCTCAAGCCTCCCAATATCCTCGAGGATATTGGGAGGCTTGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006521.3-383s21c1
Sequence:CCGGATTGTTGCTGACATAGAATTACTCGAGTAATTCTATGTCAGCAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172472
VALIDATED
TFE3 MISSION shRNA Bacterial Glycerol Stock
transcription factor binding to IGHM enhancer 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1953s1c1
Sequence:CCGGGCCACTAGAGATCCTTAGAAACTCGAGTTTCTAAGGATCTCTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-916s1c1
Sequence:CCGGGCCTAACATCAAACGCGAGATCTCGAGATCTCGCGTTTGATGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1115s1c1
Sequence:CCGGGTGGATTACATCCGCAAATTACTCGAGTAATTTGCGGATGTAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1430s1c1
Sequence:CCGGGCCCTTCTGGACCTACACTTTCTCGAGAAAGTGTAGGTCCAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1114s1c1
Sequence:CCGGTGTGGATTACATCCGCAAATTCTCGAGAATTTGCGGATGTAATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1363s21c1
Sequence:CCGGACATTAACGATAGGATCAAAGCTCGAGCTTTGATCCTATCGTTAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-422s21c1
Sequence:CCGGATCCGGGATTGTTGCTGATATCTCGAGATATCAGCAACAATCCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1223s21c1
Sequence:CCGGAGCTATCACCGTCAGCAATTCCTCGAGGAATTGCTGACGGTGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1660s21c1
Sequence:CCGGAGCCAGAACAGCTGGACATTGCTCGAGCAATGTCCAGCTGTTCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1831s21c1
Sequence:CCGGACCTAGGGCTAGAGGACATTCCTCGAGGAATGTCCTCTAGCCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172472
VALIDATED
TFE3 MISSION shRNA shRNA Plasmid DNA
transcription factor binding to IGHM enhancer 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1953s1c1
Sequence:CCGGGCCACTAGAGATCCTTAGAAACTCGAGTTTCTAAGGATCTCTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-916s1c1
Sequence:CCGGGCCTAACATCAAACGCGAGATCTCGAGATCTCGCGTTTGATGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1115s1c1
Sequence:CCGGGTGGATTACATCCGCAAATTACTCGAGTAATTTGCGGATGTAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1430s1c1
Sequence:CCGGGCCCTTCTGGACCTACACTTTCTCGAGAAAGTGTAGGTCCAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1114s1c1
Sequence:CCGGTGTGGATTACATCCGCAAATTCTCGAGAATTTGCGGATGTAATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1363s21c1
Sequence:CCGGACATTAACGATAGGATCAAAGCTCGAGCTTTGATCCTATCGTTAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-422s21c1
Sequence:CCGGATCCGGGATTGTTGCTGATATCTCGAGATATCAGCAACAATCCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1223s21c1
Sequence:CCGGAGCTATCACCGTCAGCAATTCCTCGAGGAATTGCTGACGGTGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1660s21c1
Sequence:CCGGAGCCAGAACAGCTGGACATTGCTCGAGCAATGTCCAGCTGTTCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1831s21c1
Sequence:CCGGACCTAGGGCTAGAGGACATTCCTCGAGGAATGTCCTCTAGCCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172472
VALIDATED
TFE3 MISSION shRNA Lentiviral Transduction Particles
transcription factor binding to IGHM enhancer 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1953s1c1
Sequence:CCGGGCCACTAGAGATCCTTAGAAACTCGAGTTTCTAAGGATCTCTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-916s1c1
Sequence:CCGGGCCTAACATCAAACGCGAGATCTCGAGATCTCGCGTTTGATGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1115s1c1
Sequence:CCGGGTGGATTACATCCGCAAATTACTCGAGTAATTTGCGGATGTAATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1430s1c1
Sequence:CCGGGCCCTTCTGGACCTACACTTTCTCGAGAAAGTGTAGGTCCAGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172472.1-1114s1c1
Sequence:CCGGTGTGGATTACATCCGCAAATTCTCGAGAATTTGCGGATGTAATCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1363s21c1
Sequence:CCGGACATTAACGATAGGATCAAAGCTCGAGCTTTGATCCTATCGTTAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-422s21c1
Sequence:CCGGATCCGGGATTGTTGCTGATATCTCGAGATATCAGCAACAATCCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1223s21c1
Sequence:CCGGAGCTATCACCGTCAGCAATTCCTCGAGGAATTGCTGACGGTGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1660s21c1
Sequence:CCGGAGCCAGAACAGCTGGACATTGCTCGAGCAATGTCCAGCTGTTCTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172472.3-1831s21c1
Sequence:CCGGACCTAGGGCTAGAGGACATTCCTCGAGGAATGTCCTCTAGCCCTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks